Incidental Mutation 'R1594:Fam24b'
ID175563
Institutional Source Beutler Lab
Gene Symbol Fam24b
Ensembl Gene ENSMUSG00000030858
Gene Namefamily with sequence similarity 24 member B
Synonyms
MMRRC Submission 039631-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R1594 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location131325944-131329516 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 131326296 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 55 (Y55D)
Ref Sequence ENSEMBL: ENSMUSP00000139545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033146] [ENSMUST00000046611] [ENSMUST00000124096] [ENSMUST00000188899]
Predicted Effect probably benign
Transcript: ENSMUST00000033146
AA Change: Y55D

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000033146
Gene: ENSMUSG00000030858
AA Change: Y55D

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:FAM24 78 119 1.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000046611
SMART Domains Protein: ENSMUSP00000037168
Gene: ENSMUSG00000040205

DomainStartEndE-ValueType
CUB 32 146 1.78e-16 SMART
CUB 154 265 1.1e-44 SMART
ZP 276 519 1.39e-63 SMART
transmembrane domain 571 593 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188899
AA Change: Y55D

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000139545
Gene: ENSMUSG00000030858
AA Change: Y55D

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:FAM24 33 82 1.5e-18 PFAM
Pfam:FAM24 78 119 2.8e-23 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 G A 16: 31,127,387 A264V probably benign Het
Adam17 A G 12: 21,340,470 probably null Het
Adcy10 A G 1: 165,525,033 N479D probably benign Het
C2cd2l A G 9: 44,316,773 S84P probably damaging Het
Capn13 A G 17: 73,351,479 V198A probably benign Het
Cblc G A 7: 19,792,546 S206F probably damaging Het
Ccdc7b A T 8: 129,178,357 T159S possibly damaging Het
Clpx A G 9: 65,324,270 T546A probably damaging Het
Col18a1 A G 10: 77,113,036 V214A possibly damaging Het
Csgalnact1 A T 8: 68,358,632 V462E probably damaging Het
Cts6 G A 13: 61,198,367 T202I probably damaging Het
Cwf19l2 A G 9: 3,430,973 Y435C probably benign Het
D630003M21Rik T A 2: 158,211,630 Q646L probably damaging Het
E2f2 A G 4: 136,186,830 Q297R possibly damaging Het
Eef1d T C 15: 75,896,346 E189G probably damaging Het
Fam114a2 A C 11: 57,513,240 probably null Het
Gimap6 T C 6: 48,702,191 T304A probably benign Het
Gm11232 T C 4: 71,757,335 E63G possibly damaging Het
Hbs1l A G 10: 21,352,023 M152V probably benign Het
Herc3 C A 6: 58,887,584 probably benign Het
Hmx2 A G 7: 131,555,502 D115G probably benign Het
Igsf3 C A 3: 101,451,077 Y761* probably null Het
Kbtbd13 A G 9: 65,391,619 W12R probably benign Het
Kif2c C A 4: 117,178,188 R21L probably benign Het
Kmt2c T C 5: 25,314,878 N2078S probably benign Het
Mgst3 T A 1: 167,373,810 Y102F probably damaging Het
Mov10 G T 3: 104,795,411 T946N probably damaging Het
Nbeal1 T A 1: 60,305,291 I2317N possibly damaging Het
Nid2 T A 14: 19,781,261 I741N probably benign Het
Nlrp9a G A 7: 26,570,507 W786* probably null Het
Olfr44 A C 9: 39,484,746 I166S probably benign Het
Olfr461 T C 6: 40,544,347 I211V probably benign Het
Pi4ka G T 16: 17,373,419 probably benign Het
Plcb4 A G 2: 135,970,390 probably benign Het
Psg16 A G 7: 17,093,823 T144A probably damaging Het
Sec24b A G 3: 129,991,351 V1002A probably benign Het
Shank1 A T 7: 44,327,223 K582* probably null Het
Slc22a7 T C 17: 46,438,031 D120G possibly damaging Het
Slco6c1 T A 1: 97,062,438 T676S probably benign Het
Sulf2 A G 2: 166,084,447 probably benign Het
Tgm1 T C 14: 55,709,519 D344G probably damaging Het
Tle4 C T 19: 14,453,606 W604* probably null Het
Tmco3 T C 8: 13,292,052 S109P probably damaging Het
Unc13d T G 11: 116,068,712 D647A probably benign Het
Usp19 T C 9: 108,498,522 V887A probably damaging Het
Vmn2r49 A T 7: 9,976,623 D727E probably damaging Het
Ypel1 A G 16: 17,082,121 H72R probably damaging Het
Zfp407 A G 18: 84,209,331 V2051A probably benign Het
Zfp438 A G 18: 5,213,515 L481P possibly damaging Het
Zfp850 C A 7: 27,989,391 R464L probably benign Het
Zfp985 T C 4: 147,583,080 V135A probably benign Het
Other mutations in Fam24b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Fam24b APN 7 131326174 nonsense probably null
IGL03098:Fam24b UTSW 7 131326248 missense probably benign 0.13
R0605:Fam24b UTSW 7 131327186 splice site probably benign
R8023:Fam24b UTSW 7 131326140 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CCCTTATGCTACAAAGGCAGGGTG -3'
(R):5'- GCCAGTGACTTTGGGGAAAGTGAC -3'

Sequencing Primer
(F):5'- AAAGGCAGGGTGGCAGG -3'
(R):5'- ATCTGGGTTTCACATGCATAGC -3'
Posted On2014-04-24