Incidental Mutation 'R0023:Nr1i3'
ID178038
Institutional Source Beutler Lab
Gene Symbol Nr1i3
Ensembl Gene ENSMUSG00000005677
Gene Namenuclear receptor subfamily 1, group I, member 3
SynonymsCare2, CAR1, mCAR, CAR, ESTM32, MB67
MMRRC Submission 038318-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0023 (G1)
Quality Score77
Status Validated
Chromosome1
Chromosomal Location171213970-171220701 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 171217331 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 247 (F247L)
Ref Sequence ENSEMBL: ENSMUSP00000106960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005817] [ENSMUST00000005820] [ENSMUST00000075469] [ENSMUST00000111326] [ENSMUST00000111327] [ENSMUST00000111328] [ENSMUST00000133075] [ENSMUST00000138184] [ENSMUST00000143405] [ENSMUST00000147246] [ENSMUST00000155126]
Predicted Effect probably benign
Transcript: ENSMUST00000005817
SMART Domains Protein: ENSMUSP00000005817
Gene: ENSMUSG00000005674

DomainStartEndE-ValueType
Pfam:Porin_3 26 302 7.2e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000005820
AA Change: F248L

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000005820
Gene: ENSMUSG00000005677
AA Change: F248L

DomainStartEndE-ValueType
ZnF_C4 18 89 6.98e-35 SMART
low complexity region 94 110 N/A INTRINSIC
HOLI 173 333 5.55e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075469
AA Change: F248L

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000074915
Gene: ENSMUSG00000005677
AA Change: F248L

DomainStartEndE-ValueType
ZnF_C4 18 89 6.98e-35 SMART
low complexity region 94 110 N/A INTRINSIC
HOLI 173 285 8.9e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111326
SMART Domains Protein: ENSMUSP00000106958
Gene: ENSMUSG00000005674

DomainStartEndE-ValueType
Pfam:Porin_3 26 95 9e-16 PFAM
Pfam:Porin_3 85 268 1.4e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111327
SMART Domains Protein: ENSMUSP00000106959
Gene: ENSMUSG00000005674

DomainStartEndE-ValueType
Pfam:Porin_3 26 302 3.4e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111328
AA Change: F247L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106960
Gene: ENSMUSG00000005677
AA Change: F247L

DomainStartEndE-ValueType
ZnF_C4 18 89 6.98e-35 SMART
low complexity region 94 110 N/A INTRINSIC
HOLI 173 332 5.55e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130529
Predicted Effect probably benign
Transcript: ENSMUST00000133075
SMART Domains Protein: ENSMUSP00000137852
Gene: ENSMUSG00000005677

DomainStartEndE-ValueType
ZnF_C4 18 58 1.68e-3 SMART
low complexity region 80 93 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137298
Predicted Effect probably benign
Transcript: ENSMUST00000138184
SMART Domains Protein: ENSMUSP00000115877
Gene: ENSMUSG00000005674

DomainStartEndE-ValueType
Pfam:Porin_3 26 119 1.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143405
Predicted Effect probably benign
Transcript: ENSMUST00000147246
SMART Domains Protein: ENSMUSP00000119006
Gene: ENSMUSG00000005674

DomainStartEndE-ValueType
Pfam:Porin_3 26 91 5e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155126
AA Change: F111L

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000137683
Gene: ENSMUSG00000005677
AA Change: F111L

DomainStartEndE-ValueType
HOLI 36 196 5.55e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152865
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154106
Meta Mutation Damage Score 0.4927 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nuclear receptor superfamily, and is a key regulator of xenobiotic and endobiotic metabolism. The protein binds to DNA as a monomer or a heterodimer with the retinoid X receptor and regulates the transcription of target genes involved in drug metabolism and bilirubin clearance, such as cytochrome P450 family members. Unlike most nuclear receptors, this transcriptional regulator is constitutively active in the absence of ligand but is regulated by both agonists and inverse agonists. Ligand binding results in translocation of this protein to the nucleus, where it activates or represses target gene transcription. These ligands include bilirubin, a variety of foreign compounds, steroid hormones, and prescription drugs. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased sensitivity to TCPOBOP. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik A C 4: 144,528,997 D329A probably damaging Het
Abcc12 T A 8: 86,538,333 H661L probably damaging Het
Abcg4 A G 9: 44,275,375 Y491H probably damaging Het
Acsbg2 C G 17: 56,847,710 A481P probably damaging Het
Aknad1 T A 3: 108,781,185 C610S probably benign Het
Ang4 G T 14: 51,764,403 Y29* probably null Het
Aqp11 A T 7: 97,726,689 I251N possibly damaging Het
Arid1a G T 4: 133,691,176 T1032K unknown Het
Atg16l1 T C 1: 87,789,465 V538A probably benign Het
Bbs1 C T 19: 4,906,014 A44T probably damaging Het
Bpifa3 A C 2: 154,138,150 H234P probably damaging Het
Btbd9 A T 17: 30,530,214 V42E probably damaging Het
Carmil3 C G 14: 55,492,876 S15R probably damaging Het
Casp8ap2 A G 4: 32,640,185 D413G probably damaging Het
Cfap44 T A 16: 44,421,220 F651L probably benign Het
Clcn3 A T 8: 60,933,070 probably benign Het
Crip3 A G 17: 46,430,994 K136E probably damaging Het
Ctr9 G A 7: 111,043,947 A509T possibly damaging Het
D930020B18Rik T C 10: 121,689,821 S367P probably damaging Het
Dhrs11 A T 11: 84,823,150 L125H probably damaging Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Efcab7 A T 4: 99,901,637 probably benign Het
Eif2ak4 A C 2: 118,462,721 S1253R probably damaging Het
Emc1 A G 4: 139,371,009 D767G probably damaging Het
Fads1 G A 19: 10,186,897 probably benign Het
Fbxw26 T C 9: 109,718,011 T449A probably benign Het
Frrs1 T C 3: 116,896,788 F27L probably damaging Het
Fry T C 5: 150,451,098 S2358P possibly damaging Het
Gas6 A C 8: 13,470,344 L448R probably damaging Het
Hikeshi T C 7: 89,920,204 probably benign Het
Ifngr1 C T 10: 19,609,449 R399* probably null Het
Itga2 G A 13: 114,870,496 S432L possibly damaging Het
Knl1 C T 2: 119,102,549 T2063I possibly damaging Het
Lyzl6 A G 11: 103,636,871 V9A probably benign Het
Macf1 A T 4: 123,488,314 probably benign Het
Myo6 T C 9: 80,283,534 V789A possibly damaging Het
Myo9b A T 8: 71,333,768 R693W probably damaging Het
Nasp A G 4: 116,605,771 probably benign Het
Plekhs1 T G 19: 56,478,516 S260A probably damaging Het
Rpl21-ps6 T C 17: 55,915,536 noncoding transcript Het
Rtcb A T 10: 85,949,451 probably benign Het
Sppl2a T A 2: 126,913,293 probably null Het
Suco A T 1: 161,845,585 probably null Het
Tnn T A 1: 160,104,928 T1075S probably benign Het
Traf3 T A 12: 111,243,478 C169* probably null Het
Ucp3 G T 7: 100,485,043 V288L probably benign Het
Ulk3 C A 9: 57,590,356 C4* probably null Het
Vmn1r73 A T 7: 11,757,070 T272S probably benign Het
Vmn2r115 G A 17: 23,346,278 E380K probably benign Het
Vmn2r3 T A 3: 64,275,366 N304I probably damaging Het
Xylt1 G T 7: 117,634,701 G485V probably damaging Het
Yars A G 4: 129,197,188 T130A probably benign Het
Zfp652 A T 11: 95,753,469 R205* probably null Het
Other mutations in Nr1i3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01582:Nr1i3 APN 1 171214972 missense possibly damaging 0.79
IGL02401:Nr1i3 APN 1 171216373 splice site probably benign
IGL02964:Nr1i3 APN 1 171214395 missense probably benign 0.00
election UTSW 1 171216382 missense probably damaging 0.99
R0049:Nr1i3 UTSW 1 171214413 missense probably damaging 1.00
R0049:Nr1i3 UTSW 1 171214413 missense probably damaging 1.00
R0504:Nr1i3 UTSW 1 171217236 splice site probably benign
R1437:Nr1i3 UTSW 1 171217141 frame shift probably null
R1754:Nr1i3 UTSW 1 171217394 missense probably damaging 1.00
R1893:Nr1i3 UTSW 1 171217223 critical splice donor site probably null
R2116:Nr1i3 UTSW 1 171218594 missense probably damaging 1.00
R3613:Nr1i3 UTSW 1 171214995 nonsense probably null
R3787:Nr1i3 UTSW 1 171214425 missense probably damaging 1.00
R4627:Nr1i3 UTSW 1 171216445 missense probably benign 0.00
R4772:Nr1i3 UTSW 1 171217150 missense probably damaging 1.00
R4792:Nr1i3 UTSW 1 171218595 missense probably damaging 0.99
R4880:Nr1i3 UTSW 1 171216382 missense probably damaging 0.99
R5072:Nr1i3 UTSW 1 171216813 missense probably benign 0.11
R5349:Nr1i3 UTSW 1 171215072 missense possibly damaging 0.94
R5527:Nr1i3 UTSW 1 171214352 missense possibly damaging 0.91
R6768:Nr1i3 UTSW 1 171217397 missense probably damaging 1.00
R6824:Nr1i3 UTSW 1 171214973 missense probably benign 0.00
R7011:Nr1i3 UTSW 1 171214358 missense probably benign 0.02
R7092:Nr1i3 UTSW 1 171214178 splice site probably null
R7740:Nr1i3 UTSW 1 171216827 missense probably benign 0.00
R8200:Nr1i3 UTSW 1 171217697 missense probably benign 0.44
X0027:Nr1i3 UTSW 1 171214377 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGGTCTTACATTTGCAGTGTGCC -3'
(R):5'- TGTTCAGAATCAGCGCCATCTCC -3'

Sequencing Primer
(F):5'- GACCTAAGTCTAAAGTGCCCTTG -3'
(R):5'- GGATGGTATAGATAGACCCTTGC -3'
Posted On2014-05-07