Incidental Mutation 'R1749:Gys1'
ID194197
Institutional Source Beutler Lab
Gene Symbol Gys1
Ensembl Gene ENSMUSG00000003865
Gene Nameglycogen synthase 1, muscle
SynonymsGys3, MGS
MMRRC Submission 039781-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1749 (G1)
Quality Score203
Status Not validated
Chromosome7
Chromosomal Location45434844-45456619 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45440032 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 205 (L205P)
Ref Sequence ENSEMBL: ENSMUSP00000148252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003964] [ENSMUST00000211150] [ENSMUST00000211214]
Predicted Effect probably damaging
Transcript: ENSMUST00000003964
AA Change: L269P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003964
Gene: ENSMUSG00000003865
AA Change: L269P

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
Pfam:Glyco_transf_5 28 274 5.2e-8 PFAM
Pfam:Glycogen_syn 31 663 N/A PFAM
low complexity region 670 686 N/A INTRINSIC
low complexity region 698 711 N/A INTRINSIC
low complexity region 716 733 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211150
AA Change: L205P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000211214
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the addition of glucose monomers to the growing glycogen molecule through the formation of alpha-1,4-glycoside linkages. Mutations in this gene are associated with muscle glycogen storage disease. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice display neonatal lethality due to impaired cardiac function and exhibit reduced reduced ventricular chamber size, dilated atria, vascular congestion, and liver hemorrhage. Mice homozygous for a knock-in allele show altered glycogen homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak5 A T 3: 152,472,920 M486K probably damaging Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Aspn A T 13: 49,551,785 D41V probably benign Het
Atp8a2 C A 14: 59,860,174 E802* probably null Het
Barhl2 T C 5: 106,457,706 S46G unknown Het
Cacna1e A G 1: 154,444,000 V1318A probably damaging Het
Ccdc69 T C 11: 55,051,153 R176G probably null Het
Cdan1 T C 2: 120,729,799 N321S probably damaging Het
Cep85l T C 10: 53,278,154 D681G probably damaging Het
Cntrob A T 11: 69,322,874 V30E probably damaging Het
Csmd3 C T 15: 47,585,660 G3646E probably damaging Het
Cx3cl1 A G 8: 94,780,161 probably null Het
Dab1 A T 4: 104,328,298 probably benign Het
Dennd2c T C 3: 103,132,036 S167P possibly damaging Het
Dock2 A G 11: 34,232,767 probably null Het
Dok3 GCC GC 13: 55,524,355 probably null Het
Ebf1 A T 11: 44,908,008 I287L possibly damaging Het
Eci1 G A 17: 24,426,747 probably null Het
Emb T A 13: 117,249,706 I133N possibly damaging Het
Fam91a1 A G 15: 58,426,594 I184V probably benign Het
Fbn2 T C 18: 58,050,276 D1779G probably benign Het
Fgfr4 T A 13: 55,167,792 probably null Het
Flt1 G A 5: 147,655,119 T511M probably benign Het
Hepacam2 A G 6: 3,483,379 V134A probably damaging Het
Htr3a A G 9: 48,900,933 V291A probably damaging Het
Ip6k3 T A 17: 27,145,079 T332S probably benign Het
Klra6 A T 6: 130,018,952 F148I probably damaging Het
Kntc1 T C 5: 123,789,099 S1206P probably benign Het
Mbnl2 T A 14: 120,389,050 C231S probably damaging Het
Mdn1 A T 4: 32,773,952 D5521V probably damaging Het
Mylip G A 13: 45,404,470 V52M possibly damaging Het
Naip6 A G 13: 100,308,255 S232P probably benign Het
Ndc80 T C 17: 71,501,555 K504R probably benign Het
Nf2 T C 11: 4,803,694 N220S possibly damaging Het
Nfasc T A 1: 132,611,632 I393F probably damaging Het
Olfr102 T C 17: 37,314,061 T108A probably benign Het
Pabpc1 T C 15: 36,608,340 Y56C probably damaging Het
Pcca A G 14: 122,701,130 K498R probably damaging Het
Phldb1 A G 9: 44,715,748 S467P probably damaging Het
Ptprn2 T C 12: 116,580,428 S47P probably benign Het
Rtca A T 3: 116,497,644 I229N possibly damaging Het
Sh3rf2 T A 18: 42,153,294 S617R probably damaging Het
Slc14a2 T G 18: 78,147,080 T885P possibly damaging Het
Sp100 A C 1: 85,699,636 T417P possibly damaging Het
Tat A T 8: 109,996,214 N303Y probably damaging Het
Tet2 A G 3: 133,480,131 probably null Het
Tln2 C T 9: 67,286,514 A1773T probably benign Het
Tnks1bp1 A G 2: 85,063,067 S1113G probably benign Het
Tspear G A 10: 77,869,673 E302K probably benign Het
Tulp3 A G 6: 128,337,759 L23P probably damaging Het
Vti1b T C 12: 79,165,033 E42G probably damaging Het
Yeats2 G T 16: 20,186,268 E333* probably null Het
Zfp455 T G 13: 67,207,009 C114G probably damaging Het
Zfp532 G A 18: 65,623,484 V163M possibly damaging Het
Zfp940 A T 7: 29,845,527 C318* probably null Het
Other mutations in Gys1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Gys1 APN 7 45444832 missense possibly damaging 0.88
IGL00870:Gys1 APN 7 45448013 critical splice donor site probably null
IGL01346:Gys1 APN 7 45442537 missense probably damaging 1.00
IGL02396:Gys1 APN 7 45439588 missense probably damaging 1.00
IGL03157:Gys1 APN 7 45439899 unclassified probably benign
IGL03196:Gys1 APN 7 45454817 splice site probably benign
R0095:Gys1 UTSW 7 45444649 missense possibly damaging 0.87
R0284:Gys1 UTSW 7 45436719 unclassified probably benign
R0537:Gys1 UTSW 7 45440001 missense probably damaging 1.00
R0622:Gys1 UTSW 7 45439995 missense probably damaging 1.00
R1968:Gys1 UTSW 7 45443546 missense probably damaging 1.00
R3953:Gys1 UTSW 7 45440046 missense probably damaging 1.00
R4058:Gys1 UTSW 7 45448386 splice site probably benign
R4626:Gys1 UTSW 7 45439534 missense probably damaging 1.00
R4661:Gys1 UTSW 7 45454834 missense probably damaging 1.00
R4998:Gys1 UTSW 7 45451544 intron probably benign
R5965:Gys1 UTSW 7 45455339 missense probably benign 0.25
R5987:Gys1 UTSW 7 45438105 missense probably benign 0.00
R6059:Gys1 UTSW 7 45455288 utr 3 prime probably null
R6481:Gys1 UTSW 7 45442969 missense possibly damaging 0.63
R6788:Gys1 UTSW 7 45444678 missense probably damaging 0.99
R6924:Gys1 UTSW 7 45443635 critical splice donor site probably null
R7006:Gys1 UTSW 7 45440013 missense probably damaging 1.00
R7029:Gys1 UTSW 7 45439584 missense possibly damaging 0.93
R7060:Gys1 UTSW 7 45440013 missense probably damaging 1.00
R7211:Gys1 UTSW 7 45448260 missense possibly damaging 0.88
R7237:Gys1 UTSW 7 45455162 missense probably benign 0.02
R7242:Gys1 UTSW 7 45439668 splice site probably null
R7593:Gys1 UTSW 7 45442936 missense probably damaging 0.99
R7641:Gys1 UTSW 7 45455071 missense probably damaging 0.98
R7674:Gys1 UTSW 7 45455071 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATTGTGAGACAGCCCAAAGCCC -3'
(R):5'- TCAGGATACAGAGTCAGCCAGCTTC -3'

Sequencing Primer
(F):5'- ATCGTGCTCCTAAGAGTGCAG -3'
(R):5'- AGAGTCAGCCAGCTTCATTTAC -3'
Posted On2014-05-23