Incidental Mutation 'R0537:Gys1'
ID49501
Institutional Source Beutler Lab
Gene Symbol Gys1
Ensembl Gene ENSMUSG00000003865
Gene Nameglycogen synthase 1, muscle
SynonymsGys3, MGS
MMRRC Submission 038729-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0537 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location45434844-45456619 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45440001 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 195 (S195P)
Ref Sequence ENSEMBL: ENSMUSP00000148252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003964] [ENSMUST00000211150] [ENSMUST00000211214]
Predicted Effect probably damaging
Transcript: ENSMUST00000003964
AA Change: S259P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000003964
Gene: ENSMUSG00000003865
AA Change: S259P

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
Pfam:Glyco_transf_5 28 274 5.2e-8 PFAM
Pfam:Glycogen_syn 31 663 N/A PFAM
low complexity region 670 686 N/A INTRINSIC
low complexity region 698 711 N/A INTRINSIC
low complexity region 716 733 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211150
AA Change: S195P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000211214
Meta Mutation Damage Score 0.9642 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the addition of glucose monomers to the growing glycogen molecule through the formation of alpha-1,4-glycoside linkages. Mutations in this gene are associated with muscle glycogen storage disease. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice display neonatal lethality due to impaired cardiac function and exhibit reduced reduced ventricular chamber size, dilated atria, vascular congestion, and liver hemorrhage. Mice homozygous for a knock-in allele show altered glycogen homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik A T 14: 36,096,700 K218N probably benign Het
Acot11 T C 4: 106,762,455 E156G probably benign Het
Arhgef28 A T 13: 97,957,716 N973K probably damaging Het
B4galt3 T C 1: 171,274,251 probably benign Het
Bmpr1a T C 14: 34,443,812 probably benign Het
Camkmt A T 17: 85,394,659 I184F probably benign Het
Ccdc33 T C 9: 58,117,454 Y163C probably damaging Het
Ccdc9 A G 7: 16,280,776 probably benign Het
Dars2 A T 1: 161,060,748 C201S possibly damaging Het
Dnajc1 A T 2: 18,307,956 S194R possibly damaging Het
Dock8 A G 19: 25,171,577 D1473G probably benign Het
Dpm2 T A 2: 32,572,949 probably null Het
Dsg4 T C 18: 20,458,571 S456P probably damaging Het
Gm10260 A T 13: 97,760,563 F9Y probably benign Het
Heatr6 G T 11: 83,779,464 E948* probably null Het
Itgal G A 7: 127,311,273 R518Q possibly damaging Het
Klhdc8b G C 9: 108,449,223 R158G possibly damaging Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Lrrtm4 A T 6: 80,022,120 T172S probably benign Het
Lypd1 A G 1: 125,912,867 probably benign Het
Mei1 T C 15: 82,091,361 F121S possibly damaging Het
Mtor C T 4: 148,538,360 R1966W probably damaging Het
Myh7 A G 14: 54,990,799 F247L possibly damaging Het
Nebl G T 2: 17,404,215 D392E possibly damaging Het
Notch2 C A 3: 98,116,741 N840K possibly damaging Het
Nubp1 T C 16: 10,422,814 probably benign Het
Olfr1140 A T 2: 87,746,673 Q159L probably benign Het
Olfr832 T C 9: 18,945,148 S167P probably damaging Het
Pcdh17 T A 14: 84,447,457 S455T probably damaging Het
Picalm C A 7: 90,130,668 H32Q probably benign Het
Pold1 T C 7: 44,535,092 E828G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rala A T 13: 17,888,648 N119K probably benign Het
Rasal2 A T 1: 157,147,792 V1149E possibly damaging Het
Rd3 A G 1: 191,983,540 Y92C probably damaging Het
Sart1 A T 19: 5,381,724 D635E probably damaging Het
Sec16b A G 1: 157,537,546 T335A possibly damaging Het
Slc11a2 C T 15: 100,405,798 G185R probably damaging Het
Slc2a12 G A 10: 22,665,068 R274H probably damaging Het
Spag17 T C 3: 100,125,302 V2276A probably damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tenm2 T C 11: 36,163,730 D601G probably damaging Het
Tmem168 C A 6: 13,603,361 C2F probably damaging Het
Tmem80 A G 7: 141,333,696 Y13C probably damaging Het
Try4 T A 6: 41,304,362 N79K probably benign Het
Vldlr C A 19: 27,247,918 N798K probably damaging Het
Wdr41 A G 13: 94,995,305 probably benign Het
Zfp30 A T 7: 29,792,735 E138V probably damaging Het
Zfp366 A C 13: 99,229,278 T316P probably damaging Het
Zfp563 A T 17: 33,104,685 S85C possibly damaging Het
Znfx1 T C 2: 167,041,701 H162R probably damaging Het
Other mutations in Gys1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Gys1 APN 7 45444832 missense possibly damaging 0.88
IGL00870:Gys1 APN 7 45448013 critical splice donor site probably null
IGL01346:Gys1 APN 7 45442537 missense probably damaging 1.00
IGL02396:Gys1 APN 7 45439588 missense probably damaging 1.00
IGL03157:Gys1 APN 7 45439899 unclassified probably benign
IGL03196:Gys1 APN 7 45454817 splice site probably benign
R0095:Gys1 UTSW 7 45444649 missense possibly damaging 0.87
R0284:Gys1 UTSW 7 45436719 unclassified probably benign
R0622:Gys1 UTSW 7 45439995 missense probably damaging 1.00
R1749:Gys1 UTSW 7 45440032 missense probably damaging 1.00
R1968:Gys1 UTSW 7 45443546 missense probably damaging 1.00
R3953:Gys1 UTSW 7 45440046 missense probably damaging 1.00
R4058:Gys1 UTSW 7 45448386 splice site probably benign
R4626:Gys1 UTSW 7 45439534 missense probably damaging 1.00
R4661:Gys1 UTSW 7 45454834 missense probably damaging 1.00
R4998:Gys1 UTSW 7 45451544 intron probably benign
R5965:Gys1 UTSW 7 45455339 missense probably benign 0.25
R5987:Gys1 UTSW 7 45438105 missense probably benign 0.00
R6059:Gys1 UTSW 7 45455288 splice site probably null
R6481:Gys1 UTSW 7 45442969 missense possibly damaging 0.63
R6788:Gys1 UTSW 7 45444678 missense probably damaging 0.99
R6924:Gys1 UTSW 7 45443635 critical splice donor site probably null
R7006:Gys1 UTSW 7 45440013 missense probably damaging 1.00
R7029:Gys1 UTSW 7 45439584 missense possibly damaging 0.93
R7060:Gys1 UTSW 7 45440013 missense probably damaging 1.00
R7211:Gys1 UTSW 7 45448260 missense possibly damaging 0.88
R7237:Gys1 UTSW 7 45455162 missense probably benign 0.02
R7242:Gys1 UTSW 7 45439668 splice site probably null
R7593:Gys1 UTSW 7 45442936 missense probably damaging 0.99
R7641:Gys1 UTSW 7 45455071 missense probably damaging 0.98
R7674:Gys1 UTSW 7 45455071 missense probably damaging 0.98
R7756:Gys1 UTSW 7 45448302 missense probably benign 0.43
R8197:Gys1 UTSW 7 45442924 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- ATTGTGAGACAGCCCAAAGCCC -3'
(R):5'- TCAGGATACAGAGTCAGCCAGCTTC -3'

Sequencing Primer
(F):5'- ATCGTGCTCCTAAGAGTGCAG -3'
(R):5'- AGAGTCAGCCAGCTTCATTTAC -3'
Posted On2013-06-12