Incidental Mutation 'R1737:Flg2'
ID199761
Institutional Source Beutler Lab
Gene Symbol Flg2
Ensembl Gene ENSMUSG00000049133
Gene Namefilaggrin family member 2
SynonymsEG229574
MMRRC Submission 039769-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R1737 (G1)
Quality Score102
Status Validated
Chromosome3
Chromosomal Location93197278-93221391 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93203621 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 985 (R985S)
Ref Sequence ENSEMBL: ENSMUSP00000096482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098884] [ENSMUST00000194707]
Predicted Effect unknown
Transcript: ENSMUST00000098884
AA Change: R985S
SMART Domains Protein: ENSMUSP00000096482
Gene: ENSMUSG00000049133
AA Change: R985S

DomainStartEndE-ValueType
Pfam:S_100 4 46 1.2e-17 PFAM
low complexity region 58 70 N/A INTRINSIC
low complexity region 110 121 N/A INTRINSIC
low complexity region 131 146 N/A INTRINSIC
low complexity region 207 223 N/A INTRINSIC
internal_repeat_2 230 347 7.36e-7 PROSPERO
internal_repeat_2 349 466 7.36e-7 PROSPERO
internal_repeat_3 366 392 6.93e-6 PROSPERO
internal_repeat_6 419 471 4.17e-5 PROSPERO
low complexity region 474 550 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 593 679 N/A INTRINSIC
low complexity region 680 705 N/A INTRINSIC
low complexity region 719 748 N/A INTRINSIC
low complexity region 749 768 N/A INTRINSIC
low complexity region 772 800 N/A INTRINSIC
internal_repeat_5 804 825 4.17e-5 PROSPERO
internal_repeat_3 810 836 6.93e-6 PROSPERO
low complexity region 846 860 N/A INTRINSIC
low complexity region 863 885 N/A INTRINSIC
internal_repeat_5 895 919 4.17e-5 PROSPERO
internal_repeat_4 899 939 1.7e-5 PROSPERO
internal_repeat_1 944 1461 8.08e-127 PROSPERO
internal_repeat_6 1335 1386 4.17e-5 PROSPERO
low complexity region 1465 1485 N/A INTRINSIC
internal_repeat_1 1486 2009 8.08e-127 PROSPERO
internal_repeat_4 2123 2173 1.7e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194707
SMART Domains Protein: ENSMUSP00000141201
Gene: ENSMUSG00000049133

DomainStartEndE-ValueType
SCOP:d1qlka_ 1 35 6e-10 SMART
low complexity region 53 64 N/A INTRINSIC
low complexity region 74 89 N/A INTRINSIC
low complexity region 150 166 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 97.6%
  • 3x: 96.9%
  • 10x: 95.1%
  • 20x: 91.4%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Ak7 G A 12: 105,742,332 V349M probably damaging Het
Aldh1a2 A T 9: 71,285,171 E436V possibly damaging Het
Apc C A 18: 34,317,022 P2290T probably damaging Het
Atp10a T C 7: 58,827,238 probably benign Het
Bahd1 T C 2: 118,915,923 S8P probably damaging Het
BC049715 C T 6: 136,840,308 P182L probably damaging Het
Capn10 T C 1: 92,934,955 Y28H probably benign Het
Ccdc129 A T 6: 55,968,304 D670V probably damaging Het
Cdh10 A T 15: 18,964,063 I104F probably damaging Het
Cep170b A G 12: 112,736,627 D508G possibly damaging Het
Ces2a G T 8: 104,740,824 A494S probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cltc G A 11: 86,733,727 T123M probably damaging Het
Cnot1 A G 8: 95,748,276 S1102P probably damaging Het
Col12a1 C A 9: 79,703,451 D224Y probably damaging Het
Col14a1 T A 15: 55,344,961 probably benign Het
Cyp7a1 T A 4: 6,272,848 T122S probably benign Het
Dock4 A G 12: 40,807,001 probably null Het
Eid2 T C 7: 28,268,499 V182A possibly damaging Het
Eloa A T 4: 136,010,770 V293D probably benign Het
Enkur G A 2: 21,194,295 P143S probably damaging Het
Ep300 T C 15: 81,626,347 Y99H probably damaging Het
Fbxw5 C A 2: 25,503,584 L66I probably benign Het
Fscb A T 12: 64,474,581 I37K possibly damaging Het
H2-M10.3 T C 17: 36,368,404 N3S probably benign Het
H2-Q7 A C 17: 35,439,626 Y80S probably damaging Het
H60c A T 10: 3,259,914 D124E possibly damaging Het
Hsd3b2 A T 3: 98,711,546 V361E probably damaging Het
Ice1 A C 13: 70,606,325 C547W probably damaging Het
Jmy A G 13: 93,498,795 V171A probably damaging Het
Klf7 C A 1: 64,079,213 R75L possibly damaging Het
Klk1b1 A T 7: 43,970,359 Q114L probably benign Het
Krt10 A G 11: 99,387,387 M280T possibly damaging Het
Lama1 G A 17: 67,802,921 R2179Q probably benign Het
Mbd3l1 C T 9: 18,484,929 P117S possibly damaging Het
Med18 A T 4: 132,460,109 S71R probably damaging Het
Mov10l1 T A 15: 89,011,404 I643N possibly damaging Het
Nfib T C 4: 82,498,589 K70E probably damaging Het
Nr3c2 A C 8: 76,908,329 S20R probably benign Het
Nr6a1 A T 2: 38,738,943 F356L probably benign Het
Oca2 G A 7: 56,328,785 R567H probably damaging Het
Olfr370 A G 8: 83,541,416 S91G probably benign Het
Olfr395 T A 11: 73,907,085 M136L possibly damaging Het
Olfr59 T C 11: 74,288,811 L55P probably damaging Het
Olfr794 T A 10: 129,570,828 Y58N probably damaging Het
Olfr952 T C 9: 39,426,958 T38A probably damaging Het
Pcdhb10 A G 18: 37,412,956 T362A probably benign Het
Pip5k1b A T 19: 24,397,040 V59E probably damaging Het
Pkhd1l1 G A 15: 44,547,509 probably null Het
Prr36 T C 8: 4,214,370 probably benign Het
Ptger2 A G 14: 45,001,771 T289A probably benign Het
Rad18 A G 6: 112,681,537 F136L probably damaging Het
Rhbg T A 3: 88,245,874 S258C probably damaging Het
Scgb2b27 T C 7: 34,013,314 I34M possibly damaging Het
Senp7 C A 16: 56,123,799 T135K probably damaging Het
Slc20a2 A G 8: 22,545,566 I193M probably damaging Het
Slc27a1 G A 8: 71,570,860 V47I probably benign Het
Slc9a5 G A 8: 105,368,134 V786M probably damaging Het
Smyd1 A G 6: 71,216,891 L350P probably damaging Het
Ston2 A T 12: 91,647,907 F576I probably damaging Het
Sulf2 A T 2: 166,082,678 V496E probably benign Het
Tcl1b3 C A 12: 105,191,222 S41Y probably damaging Het
Tulp2 A T 7: 45,519,777 N256I probably damaging Het
Uspl1 T A 5: 149,201,858 C349S probably damaging Het
Vcl T C 14: 21,020,536 I730T probably damaging Het
Vmn1r61 A T 7: 5,611,061 F85I probably benign Het
Zfp318 A G 17: 46,399,477 T709A probably benign Het
Zfr2 T C 10: 81,242,085 S249P probably damaging Het
Other mutations in Flg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Flg2 APN 3 93202109 nonsense probably null
IGL00092:Flg2 APN 3 93219855 missense possibly damaging 0.90
IGL00985:Flg2 APN 3 93203278 missense unknown
IGL01077:Flg2 APN 3 93220206 missense unknown
IGL01093:Flg2 APN 3 93202371 missense unknown
IGL01120:Flg2 APN 3 93201168 missense probably damaging 0.99
IGL01473:Flg2 APN 3 93203020 missense unknown
IGL01584:Flg2 APN 3 93213466 missense unknown
IGL01584:Flg2 APN 3 93215470 missense unknown
IGL01686:Flg2 APN 3 93202284 missense unknown
IGL02207:Flg2 APN 3 93220128 missense unknown
IGL02294:Flg2 APN 3 93203746 missense unknown
IGL02418:Flg2 APN 3 93201054 missense probably benign 0.26
IGL02581:Flg2 APN 3 93219892 missense unknown
IGL02719:Flg2 APN 3 93220131 nonsense probably null
IGL02795:Flg2 APN 3 93203613 missense unknown
IGL02893:Flg2 APN 3 93203613 missense unknown
IGL02958:Flg2 APN 3 93203613 missense unknown
IGL03060:Flg2 APN 3 93203613 missense unknown
IGL03088:Flg2 APN 3 93203191 missense unknown
IGL03165:Flg2 APN 3 93214611 missense unknown
IGL03342:Flg2 APN 3 93201235 missense probably damaging 1.00
IGL03352:Flg2 APN 3 93202494 missense unknown
IGL02796:Flg2 UTSW 3 93203613 missense unknown
IGL02837:Flg2 UTSW 3 93201737 missense probably damaging 1.00
PIT4618001:Flg2 UTSW 3 93203781 missense unknown
R0087:Flg2 UTSW 3 93202431 missense unknown
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0315:Flg2 UTSW 3 93214722 missense unknown
R0390:Flg2 UTSW 3 93200355 splice site probably benign
R0462:Flg2 UTSW 3 93201437 missense probably benign 0.18
R0553:Flg2 UTSW 3 93203584 missense unknown
R0828:Flg2 UTSW 3 93203332 missense unknown
R1006:Flg2 UTSW 3 93201207 missense probably benign 0.41
R1444:Flg2 UTSW 3 93202313 missense unknown
R1497:Flg2 UTSW 3 93219769 missense unknown
R1518:Flg2 UTSW 3 93203138 missense unknown
R1780:Flg2 UTSW 3 93202999 missense unknown
R1797:Flg2 UTSW 3 93200976 missense probably damaging 1.00
R2065:Flg2 UTSW 3 93202231 missense unknown
R2168:Flg2 UTSW 3 93201937 missense probably damaging 1.00
R2220:Flg2 UTSW 3 93202185 missense unknown
R2292:Flg2 UTSW 3 93220677 missense unknown
R2327:Flg2 UTSW 3 93203606 nonsense probably null
R2512:Flg2 UTSW 3 93201775 missense probably damaging 1.00
R3177:Flg2 UTSW 3 93214888 missense unknown
R3277:Flg2 UTSW 3 93214888 missense unknown
R3522:Flg2 UTSW 3 93220027 missense unknown
R3779:Flg2 UTSW 3 93202423 missense unknown
R3926:Flg2 UTSW 3 93203215 missense unknown
R4082:Flg2 UTSW 3 93203521 missense unknown
R4407:Flg2 UTSW 3 93214869 missense unknown
R5152:Flg2 UTSW 3 93214977 missense unknown
R5253:Flg2 UTSW 3 93200812 missense probably damaging 1.00
R5290:Flg2 UTSW 3 93220566 missense unknown
R5464:Flg2 UTSW 3 93201970 missense possibly damaging 0.73
R5539:Flg2 UTSW 3 93220446 missense unknown
R5622:Flg2 UTSW 3 93202564 missense unknown
R5788:Flg2 UTSW 3 93200989 missense probably benign 0.41
R5792:Flg2 UTSW 3 93203497 missense unknown
R5831:Flg2 UTSW 3 93200234 missense probably damaging 1.00
R5877:Flg2 UTSW 3 93203449 missense unknown
R6041:Flg2 UTSW 3 93220361 missense probably benign 0.01
R6189:Flg2 UTSW 3 93220074 missense unknown
R6214:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6215:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6239:Flg2 UTSW 3 93201272 missense probably benign 0.36
R6288:Flg2 UTSW 3 93203785 missense unknown
R6413:Flg2 UTSW 3 93220376 missense unknown
R6457:Flg2 UTSW 3 93220482 missense unknown
R6468:Flg2 UTSW 3 93214421 missense unknown
R6667:Flg2 UTSW 3 93201761 missense possibly damaging 0.88
R6930:Flg2 UTSW 3 93201335 nonsense probably null
R6996:Flg2 UTSW 3 93202670 missense unknown
R6996:Flg2 UTSW 3 93202949 missense unknown
R7100:Flg2 UTSW 3 93203711 missense unknown
R7133:Flg2 UTSW 3 93219762 missense unknown
R7180:Flg2 UTSW 3 93202833 missense unknown
R7325:Flg2 UTSW 3 93203372 missense unknown
R7349:Flg2 UTSW 3 93220206 missense unknown
R7531:Flg2 UTSW 3 93200870 missense probably damaging 0.99
R7571:Flg2 UTSW 3 93219996 nonsense probably null
R7684:Flg2 UTSW 3 93219649 missense unknown
R7810:Flg2 UTSW 3 93200241 missense possibly damaging 0.70
R7853:Flg2 UTSW 3 93220747 missense unknown
R7936:Flg2 UTSW 3 93220747 missense unknown
R8031:Flg2 UTSW 3 93220214 missense unknown
Z1177:Flg2 UTSW 3 93202420 missense unknown
Z1177:Flg2 UTSW 3 93202738 missense unknown
Predicted Primers PCR Primer
(F):5'- GCTTTGGGGAGAATGAATCAGGACC -3'
(R):5'- TCTCTGTGAGACTTCTGAGTGTGCC -3'

Sequencing Primer
(F):5'- CAACAGAGAGAGTCTTTTCATGGC -3'
(R):5'- GACTTCTGAGTGTGCCTCACC -3'
Posted On2014-05-23