Incidental Mutation 'R1744:Psg29'
ID200585
Institutional Source Beutler Lab
Gene Symbol Psg29
Ensembl Gene ENSMUSG00000023159
Gene Namepregnancy-specific glycoprotein 29
Synonymscea17
MMRRC Submission 039776-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R1744 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location17203477-17215760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17210353 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 263 (C263R)
Ref Sequence ENSEMBL: ENSMUSP00000075320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075934]
Predicted Effect probably damaging
Transcript: ENSMUST00000075934
AA Change: C263R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075320
Gene: ENSMUSG00000023159
AA Change: C263R

DomainStartEndE-ValueType
IG 40 137 7.77e-1 SMART
IG 156 257 8.72e-4 SMART
IG 276 377 2.44e0 SMART
IGc2 393 457 3.06e-8 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.8%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 A G 5: 81,794,420 E1247G probably damaging Het
Bcl2l15 T A 3: 103,838,540 L165Q probably damaging Het
Cd163 C A 6: 124,307,028 A53E possibly damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Clca3a1 G T 3: 144,746,835 A629D probably damaging Het
Csde1 T A 3: 103,050,315 S463R probably benign Het
Cth C G 3: 157,906,268 R304P probably damaging Het
D7Ertd443e A G 7: 134,349,413 V177A probably benign Het
Ddx56 G A 11: 6,266,396 R189W probably damaging Het
Dennd2a A T 6: 39,480,251 F752L probably benign Het
Gabrp A T 11: 33,572,462 V28E probably benign Het
Gpam T C 19: 55,074,591 E763G probably damaging Het
Hars G A 18: 36,770,832 R266C probably benign Het
Klf7 C A 1: 64,079,213 R75L possibly damaging Het
Kmt2d T C 15: 98,865,047 K281E probably damaging Het
Lbx1 T C 19: 45,234,213 K124E probably damaging Het
Lcp2 T C 11: 34,069,911 probably null Het
Mab21l2 T C 3: 86,546,904 E263G possibly damaging Het
Macf1 A T 4: 123,475,853 I140K probably damaging Het
Mcemp1 G A 8: 3,666,054 A20T probably damaging Het
Met T C 6: 17,540,646 V137A possibly damaging Het
Mgat5 T C 1: 127,479,469 F624S probably damaging Het
Nutm2 T C 13: 50,469,354 I29T probably benign Het
Ociad1 T C 5: 73,300,719 probably null Het
Ogfod2 G A 5: 124,114,156 probably null Het
Olfr816 A C 10: 129,911,393 V295G probably damaging Het
Olfr967 A C 9: 39,750,415 T10P probably benign Het
Otoa G A 7: 121,127,776 probably benign Het
Otud3 A C 4: 138,895,748 L394R probably damaging Het
Pde5a T C 3: 122,747,897 V12A probably damaging Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Prr27 A G 5: 87,843,047 I173V possibly damaging Het
Ptprm T C 17: 66,689,366 Y1242C probably damaging Het
Retsat C T 6: 72,606,575 R84* probably null Het
Rif1 G A 2: 52,112,392 V1953I possibly damaging Het
Ros1 A T 10: 52,123,379 N1137K probably damaging Het
Scn1a T C 2: 66,322,276 H787R probably benign Het
Sec16a T C 2: 26,439,186 E939G probably damaging Het
Sh2d4a G A 8: 68,331,155 G247D possibly damaging Het
Siglec1 A G 2: 131,081,299 S509P probably damaging Het
Slc25a30 A G 14: 75,763,330 I278T probably damaging Het
Slc6a20a C T 9: 123,662,993 V104I probably benign Het
Sp110 G C 1: 85,594,372 T70S probably benign Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Stxbp1 A G 2: 32,806,719 probably null Het
Tmem132b T C 5: 125,778,844 probably null Het
Tmem2 C A 19: 21,832,137 Y960* probably null Het
Tnfsf13b G A 8: 10,031,661 probably null Het
Trappc6a A G 7: 19,514,229 E38G probably damaging Het
Trps1 T C 15: 50,661,213 D857G probably damaging Het
Tspear T A 10: 77,864,884 probably null Het
Vmn1r23 A T 6: 57,925,925 N289K possibly damaging Het
Zcchc8 G A 5: 123,700,373 Q701* probably null Het
Zfp618 A T 4: 63,086,634 probably benign Het
Other mutations in Psg29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Psg29 APN 7 17208732 missense probably benign 0.42
IGL01107:Psg29 APN 7 17204925 missense probably benign 0.01
IGL01348:Psg29 APN 7 17210673 missense probably benign 0.09
IGL01353:Psg29 APN 7 17205013 missense possibly damaging 0.54
IGL02546:Psg29 APN 7 17208782 missense probably damaging 1.00
IGL02611:Psg29 APN 7 17208791 missense probably benign 0.15
IGL02982:Psg29 APN 7 17211707 missense probably damaging 0.98
IGL03072:Psg29 APN 7 17208794 missense probably benign 0.06
macular UTSW 7 17210535 missense probably benign 0.23
papular UTSW 7 17211912 makesense probably null
R2272:Psg29 UTSW 7 17210696 missense probably benign 0.19
R3054:Psg29 UTSW 7 17208802 missense probably benign 0.29
R3790:Psg29 UTSW 7 17205025 missense possibly damaging 0.71
R3963:Psg29 UTSW 7 17208585 missense probably benign 0.01
R4464:Psg29 UTSW 7 17210650 missense possibly damaging 0.61
R4740:Psg29 UTSW 7 17208533 missense probably benign 0.00
R4774:Psg29 UTSW 7 17210535 missense probably benign 0.23
R4902:Psg29 UTSW 7 17211912 makesense probably null
R4977:Psg29 UTSW 7 17208631 missense probably damaging 1.00
R5071:Psg29 UTSW 7 17211838 missense probably damaging 1.00
R5072:Psg29 UTSW 7 17211838 missense probably damaging 1.00
R5074:Psg29 UTSW 7 17211838 missense probably damaging 1.00
R5169:Psg29 UTSW 7 17211653 missense probably damaging 1.00
R5415:Psg29 UTSW 7 17211636 splice site probably null
R5729:Psg29 UTSW 7 17210534 missense probably damaging 0.98
R6023:Psg29 UTSW 7 17210512 missense possibly damaging 0.82
R6127:Psg29 UTSW 7 17211746 missense probably benign 0.00
R6900:Psg29 UTSW 7 17204932 nonsense probably null
R7142:Psg29 UTSW 7 17210621 missense probably damaging 1.00
R7297:Psg29 UTSW 7 17210691 nonsense probably null
R7448:Psg29 UTSW 7 17211723 missense possibly damaging 0.90
R7973:Psg29 UTSW 7 17210537 missense probably benign 0.03
R8027:Psg29 UTSW 7 17208640 missense possibly damaging 0.69
X0017:Psg29 UTSW 7 17210661 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGGGCTTCATCTCAAACCTGAGTG -3'
(R):5'- GATCCGTTGGCATACACCGTATCTC -3'

Sequencing Primer
(F):5'- AAATGATGCTTTCAGGGATGC -3'
(R):5'- CCCCAGGTGGTGATATTCC -3'
Posted On2014-05-23