Incidental Mutation 'R1744:Zcchc8'
ID 200576
Institutional Source Beutler Lab
Gene Symbol Zcchc8
Ensembl Gene ENSMUSG00000029427
Gene Name zinc finger, CCHC domain containing 8
Synonyms 5730565F05Rik
MMRRC Submission 039776-MU
Accession Numbers

Genbank: NM_027494; MGI: 1917900

Is this an essential gene? Possibly non essential (E-score: 0.336) question?
Stock # R1744 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 123698294-123721100 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 123700373 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 701 (Q701*)
Ref Sequence ENSEMBL: ENSMUSP00000142363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031376] [ENSMUST00000196282]
AlphaFold Q9CYA6
Predicted Effect probably null
Transcript: ENSMUST00000031376
AA Change: Q701*
SMART Domains Protein: ENSMUSP00000031376
Gene: ENSMUSG00000029427
AA Change: Q701*

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 48 83 N/A INTRINSIC
ZnF_C2HC 231 247 4.13e-3 SMART
PSP 286 338 3.04e-27 SMART
low complexity region 410 434 N/A INTRINSIC
low complexity region 464 500 N/A INTRINSIC
low complexity region 520 527 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196042
Predicted Effect probably null
Transcript: ENSMUST00000196282
AA Change: Q701*
SMART Domains Protein: ENSMUSP00000142363
Gene: ENSMUSG00000029427
AA Change: Q701*

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 48 83 N/A INTRINSIC
ZnF_C2HC 231 247 4.13e-3 SMART
PSP 286 338 3.04e-27 SMART
low complexity region 410 434 N/A INTRINSIC
low complexity region 464 500 N/A INTRINSIC
low complexity region 520 527 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199875
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.8%
Validation Efficiency 98% (59/60)
Allele List at MGI

All alleles(12) : Gene trapped(12)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 A G 5: 81,794,420 E1247G probably damaging Het
Bcl2l15 T A 3: 103,838,540 L165Q probably damaging Het
Cd163 C A 6: 124,307,028 A53E possibly damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Clca3a1 G T 3: 144,746,835 A629D probably damaging Het
Csde1 T A 3: 103,050,315 S463R probably benign Het
Cth C G 3: 157,906,268 R304P probably damaging Het
D7Ertd443e A G 7: 134,349,413 V177A probably benign Het
Ddx56 G A 11: 6,266,396 R189W probably damaging Het
Dennd2a A T 6: 39,480,251 F752L probably benign Het
Gabrp A T 11: 33,572,462 V28E probably benign Het
Gpam T C 19: 55,074,591 E763G probably damaging Het
Hars G A 18: 36,770,832 R266C probably benign Het
Klf7 C A 1: 64,079,213 R75L possibly damaging Het
Kmt2d T C 15: 98,865,047 K281E probably damaging Het
Lbx1 T C 19: 45,234,213 K124E probably damaging Het
Lcp2 T C 11: 34,069,911 probably null Het
Mab21l2 T C 3: 86,546,904 E263G possibly damaging Het
Macf1 A T 4: 123,475,853 I140K probably damaging Het
Mcemp1 G A 8: 3,666,054 A20T probably damaging Het
Met T C 6: 17,540,646 V137A possibly damaging Het
Mgat5 T C 1: 127,479,469 F624S probably damaging Het
Nutm2 T C 13: 50,469,354 I29T probably benign Het
Ociad1 T C 5: 73,300,719 probably null Het
Ogfod2 G A 5: 124,114,156 probably null Het
Olfr816 A C 10: 129,911,393 V295G probably damaging Het
Olfr967 A C 9: 39,750,415 T10P probably benign Het
Otoa G A 7: 121,127,776 probably benign Het
Otud3 A C 4: 138,895,748 L394R probably damaging Het
Pde5a T C 3: 122,747,897 V12A probably damaging Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Prr27 A G 5: 87,843,047 I173V possibly damaging Het
Psg29 T C 7: 17,210,353 C263R probably damaging Het
Ptprm T C 17: 66,689,366 Y1242C probably damaging Het
Retsat C T 6: 72,606,575 R84* probably null Het
Rif1 G A 2: 52,112,392 V1953I possibly damaging Het
Ros1 A T 10: 52,123,379 N1137K probably damaging Het
Scn1a T C 2: 66,322,276 H787R probably benign Het
Sec16a T C 2: 26,439,186 E939G probably damaging Het
Sh2d4a G A 8: 68,331,155 G247D possibly damaging Het
Siglec1 A G 2: 131,081,299 S509P probably damaging Het
Slc25a30 A G 14: 75,763,330 I278T probably damaging Het
Slc6a20a C T 9: 123,662,993 V104I probably benign Het
Sp110 G C 1: 85,594,372 T70S probably benign Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Stxbp1 A G 2: 32,806,719 probably null Het
Tmem132b T C 5: 125,778,844 probably null Het
Tmem2 C A 19: 21,832,137 Y960* probably null Het
Tnfsf13b G A 8: 10,031,661 probably null Het
Trappc6a A G 7: 19,514,229 E38G probably damaging Het
Trps1 T C 15: 50,661,213 D857G probably damaging Het
Tspear T A 10: 77,864,884 probably null Het
Vmn1r23 A T 6: 57,925,925 N289K possibly damaging Het
Zfp618 A T 4: 63,086,634 probably benign Het
Other mutations in Zcchc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01341:Zcchc8 APN 5 123704569 missense probably benign 0.43
IGL01536:Zcchc8 APN 5 123720719 critical splice donor site probably null
IGL02083:Zcchc8 APN 5 123700918 missense probably damaging 1.00
IGL02838:Zcchc8 APN 5 123719483 splice site probably benign
3-1:Zcchc8 UTSW 5 123709481 missense probably damaging 1.00
PIT4515001:Zcchc8 UTSW 5 123700932 missense probably benign 0.23
R0127:Zcchc8 UTSW 5 123707337 missense probably damaging 1.00
R1134:Zcchc8 UTSW 5 123717027 missense probably damaging 1.00
R1604:Zcchc8 UTSW 5 123700658 missense probably benign 0.00
R2216:Zcchc8 UTSW 5 123707403 missense probably damaging 1.00
R2303:Zcchc8 UTSW 5 123700597 missense probably benign 0.00
R2877:Zcchc8 UTSW 5 123700703 missense probably benign 0.05
R2964:Zcchc8 UTSW 5 123720867 missense probably benign 0.00
R2966:Zcchc8 UTSW 5 123720867 missense probably benign 0.00
R6831:Zcchc8 UTSW 5 123700909 missense probably damaging 1.00
R7908:Zcchc8 UTSW 5 123720720 critical splice donor site probably benign
R8738:Zcchc8 UTSW 5 123703007 missense probably damaging 0.99
R8791:Zcchc8 UTSW 5 123707299 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CCTTCACTCTTGACAGACACTCACG -3'
(R):5'- ATGCTCTTCTCGACAATGGCGG -3'

Sequencing Primer
(F):5'- CACGCAAACTCTGGGTTG -3'
(R):5'- TGTGTTGAACATGAACATGAGC -3'
Posted On 2014-05-23