Incidental Mutation 'R0005:Pramef12'
ID201300
Institutional Source Beutler Lab
Gene Symbol Pramef12
Ensembl Gene ENSMUSG00000028591
Gene NamePRAME family member 12
Synonyms4930569K13Rik
MMRRC Submission 038301-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R0005 (G1)
Quality Score56
Status Validated
Chromosome4
Chromosomal Location144391674-144408464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 144395853 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 40 (F40L)
Ref Sequence ENSEMBL: ENSMUSP00000030326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030326] [ENSMUST00000123854]
Predicted Effect probably damaging
Transcript: ENSMUST00000030326
AA Change: F40L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000030326
Gene: ENSMUSG00000028591
AA Change: F40L

DomainStartEndE-ValueType
SCOP:d1a4ya_ 223 414 7e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123854
AA Change: F40L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.3831 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn2l A G 7: 126,498,274 F201L probably damaging Het
BC037034 T C 5: 138,262,654 probably null Het
Camsap3 T A 8: 3,604,288 F653I probably damaging Het
Col11a2 C T 17: 34,062,879 probably benign Het
Col27a1 A G 4: 63,225,400 T442A probably benign Het
Cpsf1 A G 15: 76,600,680 probably null Het
Enpp4 T C 17: 44,102,175 N156S probably benign Het
Fat3 T A 9: 15,962,866 N3485I probably damaging Het
Gabra2 C T 5: 70,973,436 V350I probably benign Het
Gm8909 G T 17: 36,162,192 probably benign Het
Hivep2 A G 10: 14,128,749 T364A probably damaging Het
Kif1b A T 4: 149,181,927 V402E probably damaging Het
Lamc3 A G 2: 31,922,428 D959G probably benign Het
Mag T A 7: 30,908,354 probably benign Het
Map3k1 A G 13: 111,755,704 F1006L probably benign Het
Mapre2 G A 18: 23,853,693 G54D probably damaging Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Myadm C T 7: 3,297,564 Q281* probably null Het
Mylk3 A T 8: 85,327,203 V625D possibly damaging Het
Nlrp9a T C 7: 26,573,788 probably benign Het
Olfr974 A G 9: 39,942,956 D232G probably benign Het
Plcz1 T A 6: 140,040,564 probably benign Het
Plekhg5 TCCCCC TCC 4: 152,112,651 probably benign Het
Plekhh2 A C 17: 84,586,433 D892A probably benign Het
Ppih A G 4: 119,318,601 probably benign Het
Rtn4ip1 A T 10: 43,932,478 M84L probably benign Het
Slc35f4 G A 14: 49,322,486 probably benign Het
Spocd1 G T 4: 129,956,778 D866Y possibly damaging Het
Stxbp4 C T 11: 90,548,917 R365Q possibly damaging Het
Tmed4 C T 11: 6,271,781 R185H probably damaging Het
Tmem2 A G 19: 21,812,220 T595A probably damaging Het
Tnfsf9 T C 17: 57,107,236 V221A possibly damaging Het
Vsx2 C A 12: 84,570,241 P100Q possibly damaging Het
Wdr48 T A 9: 119,909,434 D53E probably benign Het
Zfp335 T A 2: 164,909,302 S115C possibly damaging Het
Zfp608 G A 18: 54,895,520 P1274S possibly damaging Het
Other mutations in Pramef12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Pramef12 APN 4 144394740 missense possibly damaging 0.91
IGL01107:Pramef12 APN 4 144393094 missense probably benign 0.00
IGL01935:Pramef12 APN 4 144392602 unclassified probably benign
IGL02436:Pramef12 APN 4 144392969 missense possibly damaging 0.95
IGL02491:Pramef12 APN 4 144394752 missense probably damaging 1.00
IGL02744:Pramef12 APN 4 144392923 missense probably damaging 1.00
IGL03338:Pramef12 APN 4 144394827 missense probably benign 0.01
R1401:Pramef12 UTSW 4 144395088 missense probably benign 0.00
R1611:Pramef12 UTSW 4 144392812 missense probably benign 0.20
R1667:Pramef12 UTSW 4 144393036 nonsense probably null
R2017:Pramef12 UTSW 4 144394674 missense possibly damaging 0.49
R2290:Pramef12 UTSW 4 144394699 missense probably benign 0.00
R2290:Pramef12 UTSW 4 144395122 missense probably benign 0.19
R2310:Pramef12 UTSW 4 144392905 unclassified probably null
R2912:Pramef12 UTSW 4 144392734 missense probably damaging 1.00
R2913:Pramef12 UTSW 4 144392734 missense probably damaging 1.00
R4558:Pramef12 UTSW 4 144395972 start codon destroyed probably null 1.00
R5162:Pramef12 UTSW 4 144394912 missense probably damaging 0.96
R5521:Pramef12 UTSW 4 144395971 start codon destroyed probably null 1.00
R5530:Pramef12 UTSW 4 144392662 missense probably benign 0.03
R5669:Pramef12 UTSW 4 144395843 missense probably benign 0.03
R6032:Pramef12 UTSW 4 144393028 missense possibly damaging 0.82
R6032:Pramef12 UTSW 4 144393028 missense possibly damaging 0.82
R6314:Pramef12 UTSW 4 144394587 missense probably damaging 0.98
R6322:Pramef12 UTSW 4 144392905 missense probably benign 0.09
R6431:Pramef12 UTSW 4 144393083 missense possibly damaging 0.83
R7729:Pramef12 UTSW 4 144392864 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAATGGTCCAATGGCCTGTG -3'
(R):5'- ATCCAAGGCAGATCAGTGGCTGTG -3'

Sequencing Primer
(F):5'- GTCCAATGGCCTGTGAAATC -3'
(R):5'- GAGAAGGACTTCTTAATCCGTGACC -3'
Posted On2014-05-28