Incidental Mutation 'R0676:Rbpj'
ID201525
Institutional Source Beutler Lab
Gene Symbol Rbpj
Ensembl Gene ENSMUSG00000039191
Gene Namerecombination signal binding protein for immunoglobulin kappa J region
SynonymsRBP-J kappa, CBF1, Igkjrb, RBPjk, Igkrsbp, Rbpsuh
MMRRC Submission 038861-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0676 (G1)
Quality Score70
Status Validated
Chromosome5
Chromosomal Location53466152-53657362 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 53646048 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037618] [ENSMUST00000087360] [ENSMUST00000113865] [ENSMUST00000201883] [ENSMUST00000201912] [ENSMUST00000201991]
Predicted Effect probably benign
Transcript: ENSMUST00000037618
SMART Domains Protein: ENSMUSP00000040694
Gene: ENSMUSG00000039191

DomainStartEndE-ValueType
LAG1_DNAbind 73 204 2.97e-86 SMART
BTD 205 354 8.01e-92 SMART
SCOP:d1a02n1 380 472 8e-29 SMART
low complexity region 508 526 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087360
SMART Domains Protein: ENSMUSP00000084618
Gene: ENSMUSG00000039191

DomainStartEndE-ValueType
LAG1_DNAbind 32 163 2.97e-86 SMART
BTD 164 313 8.01e-92 SMART
Pfam:TIG 340 429 3.6e-9 PFAM
low complexity region 467 485 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113865
SMART Domains Protein: ENSMUSP00000109496
Gene: ENSMUSG00000039191

DomainStartEndE-ValueType
LAG1_DNAbind 34 165 2.97e-86 SMART
BTD 166 315 8.01e-92 SMART
Pfam:TIG 342 431 6.1e-9 PFAM
low complexity region 469 487 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200856
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201701
Predicted Effect probably benign
Transcript: ENSMUST00000201883
SMART Domains Protein: ENSMUSP00000143846
Gene: ENSMUSG00000039191

DomainStartEndE-ValueType
LAG1_DNAbind 12 143 2.3e-90 SMART
BTD 144 293 6e-96 SMART
SCOP:d1a02n1 319 411 4e-29 SMART
low complexity region 447 465 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201912
SMART Domains Protein: ENSMUSP00000143866
Gene: ENSMUSG00000039191

DomainStartEndE-ValueType
LAG1_DNAbind 54 185 2.97e-86 SMART
BTD 186 335 8.01e-92 SMART
SCOP:d1a02n1 361 453 6e-29 SMART
low complexity region 489 507 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201928
Predicted Effect probably benign
Transcript: ENSMUST00000201991
SMART Domains Protein: ENSMUSP00000144617
Gene: ENSMUSG00000039191

DomainStartEndE-ValueType
LAG1_DNAbind 42 173 2.3e-90 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202476
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional regulator important in the Notch signaling pathway. The encoded protein acts as a repressor when not bound to Notch proteins and an activator when bound to Notch proteins. It is thought to function by recruiting chromatin remodeling complexes containing histone deacetylase or histone acetylase proteins to Notch signaling pathway genes. Several transcript variants encoding different isoforms have been found for this gene, and several pseudogenes of this gene exist on chromosome 9. [provided by RefSeq, Oct 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit complete prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A G 5: 87,964,657 probably benign Het
Arhgef25 A G 10: 127,184,010 probably null Het
B3galnt2 T C 13: 13,995,793 S243P probably benign Het
Col11a2 A G 17: 34,057,275 N799D probably damaging Het
Cpb1 T C 3: 20,266,533 probably null Het
Crot A C 5: 8,993,622 probably benign Het
Ctnna3 A C 10: 64,409,261 H451P probably benign Het
Cts6 C T 13: 61,197,484 probably benign Het
Dock2 T C 11: 34,695,236 T540A probably damaging Het
Dysf C A 6: 84,113,336 F956L probably benign Het
Gabrg3 A T 7: 56,724,421 Y466N probably damaging Het
Gm10845 T A 14: 79,863,204 noncoding transcript Het
H2-M5 A G 17: 36,989,142 F47L possibly damaging Het
Hist1h4i T C 13: 22,041,106 probably null Het
Il1rl1 CTTGTTGTTGTTGTTGTTG CTTGTTGTTGTTGTTGTTGTTG 1: 40,442,574 probably benign Het
Immt A G 6: 71,851,844 S128G probably benign Het
Klb A T 5: 65,379,055 D576V probably damaging Het
Lpin1 A T 12: 16,540,979 N817K possibly damaging Het
Lrrk1 C T 7: 66,294,981 R627H probably damaging Het
Luzp1 A G 4: 136,542,685 K740E probably damaging Het
Mapk9 T C 11: 49,883,156 *382Q probably null Het
Mn1 A G 5: 111,421,034 S957G possibly damaging Het
Mrgprb8 A T 7: 48,388,664 M28L probably benign Het
Myo1a A G 10: 127,719,880 I913V probably benign Het
Nolc1 T A 19: 46,080,089 probably benign Het
Pde4dip A C 3: 97,717,097 probably benign Het
Ric1 T C 19: 29,577,647 I387T probably benign Het
Ruvbl1 A G 6: 88,473,200 R58G probably damaging Het
Scarb1 C A 5: 125,297,214 probably benign Het
Sh3tc1 A T 5: 35,719,114 probably benign Het
Slc22a23 G A 13: 34,195,479 T435I probably damaging Het
Slc22a26 A T 19: 7,796,144 probably benign Het
Taf6l T C 19: 8,773,369 I114V probably benign Het
Tbc1d8b A G X: 139,712,276 S284G possibly damaging Het
Tmem131l C T 3: 83,934,815 probably benign Het
Vmn2r115 C T 17: 23,346,264 S375F probably benign Het
Other mutations in Rbpj
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01895:Rbpj APN 5 53651386 missense probably damaging 1.00
IGL02537:Rbpj APN 5 53642143 missense probably damaging 1.00
R2372:Rbpj UTSW 5 53642195 splice site probably benign
R3814:Rbpj UTSW 5 53653172 nonsense probably null
R4153:Rbpj UTSW 5 53649447 missense probably damaging 1.00
R5023:Rbpj UTSW 5 53649415 missense probably damaging 1.00
R5240:Rbpj UTSW 5 53649440 missense probably damaging 1.00
R5341:Rbpj UTSW 5 53642083 missense possibly damaging 0.71
R6088:Rbpj UTSW 5 53651368 unclassified probably null
R6885:Rbpj UTSW 5 53653151 missense probably damaging 1.00
R7493:Rbpj UTSW 5 53600934 missense probably benign 0.19
R7653:Rbpj UTSW 5 53590351 start codon destroyed probably null
R7703:Rbpj UTSW 5 53645898 missense probably damaging 1.00
R7893:Rbpj UTSW 5 53645874 missense probably damaging 1.00
R7976:Rbpj UTSW 5 53645874 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATTCTGAGGTGAAGGTGCATGAC -3'
(R):5'- CCGAATGCCCCTGGAAACAGTAAG -3'

Sequencing Primer
(F):5'- TGAAGGTGCATGACCATCG -3'
(R):5'- CATTGAGACTCACTCACTTCATTAGG -3'
Posted On2014-06-19