Incidental Mutation 'R5240:Rbpj'
ID400707
Institutional Source Beutler Lab
Gene Symbol Rbpj
Ensembl Gene ENSMUSG00000039191
Gene Namerecombination signal binding protein for immunoglobulin kappa J region
SynonymsRBP-J kappa, CBF1, Igkjrb, RBPjk, Igkrsbp, Rbpsuh
MMRRC Submission 042811-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5240 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location53466152-53657362 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 53649440 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 209 (Y209F)
Ref Sequence ENSEMBL: ENSMUSP00000143866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037618] [ENSMUST00000087360] [ENSMUST00000113865] [ENSMUST00000201883] [ENSMUST00000201912] [ENSMUST00000201991]
Predicted Effect probably damaging
Transcript: ENSMUST00000037618
AA Change: Y228F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040694
Gene: ENSMUSG00000039191
AA Change: Y228F

DomainStartEndE-ValueType
LAG1_DNAbind 73 204 2.97e-86 SMART
BTD 205 354 8.01e-92 SMART
SCOP:d1a02n1 380 472 8e-29 SMART
low complexity region 508 526 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000087360
AA Change: Y187F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084618
Gene: ENSMUSG00000039191
AA Change: Y187F

DomainStartEndE-ValueType
LAG1_DNAbind 32 163 2.97e-86 SMART
BTD 164 313 8.01e-92 SMART
Pfam:TIG 340 429 3.6e-9 PFAM
low complexity region 467 485 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113865
AA Change: Y189F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109496
Gene: ENSMUSG00000039191
AA Change: Y189F

DomainStartEndE-ValueType
LAG1_DNAbind 34 165 2.97e-86 SMART
BTD 166 315 8.01e-92 SMART
Pfam:TIG 342 431 6.1e-9 PFAM
low complexity region 469 487 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201883
AA Change: Y167F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143846
Gene: ENSMUSG00000039191
AA Change: Y167F

DomainStartEndE-ValueType
LAG1_DNAbind 12 143 2.3e-90 SMART
BTD 144 293 6e-96 SMART
SCOP:d1a02n1 319 411 4e-29 SMART
low complexity region 447 465 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201912
AA Change: Y209F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143866
Gene: ENSMUSG00000039191
AA Change: Y209F

DomainStartEndE-ValueType
LAG1_DNAbind 54 185 2.97e-86 SMART
BTD 186 335 8.01e-92 SMART
SCOP:d1a02n1 361 453 6e-29 SMART
low complexity region 489 507 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201928
Predicted Effect probably benign
Transcript: ENSMUST00000201991
SMART Domains Protein: ENSMUSP00000144617
Gene: ENSMUSG00000039191

DomainStartEndE-ValueType
LAG1_DNAbind 42 173 2.3e-90 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202092
Meta Mutation Damage Score 0.6972 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional regulator important in the Notch signaling pathway. The encoded protein acts as a repressor when not bound to Notch proteins and an activator when bound to Notch proteins. It is thought to function by recruiting chromatin remodeling complexes containing histone deacetylase or histone acetylase proteins to Notch signaling pathway genes. Several transcript variants encoding different isoforms have been found for this gene, and several pseudogenes of this gene exist on chromosome 9. [provided by RefSeq, Oct 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit complete prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cdc42bpg T G 19: 6,315,899 L786R probably damaging Het
Cfap73 C T 5: 120,629,707 V260I probably damaging Het
Chchd10 A T 10: 75,937,449 N131I probably damaging Het
Chn2 T C 6: 54,220,695 V190A probably benign Het
Clec2l C T 6: 38,673,452 T64I probably damaging Het
Cpeb3 T A 19: 37,174,515 T154S probably damaging Het
D130043K22Rik A G 13: 24,877,977 E643G probably damaging Het
Ddx31 A G 2: 28,846,030 M127V probably benign Het
Dennd1b A G 1: 139,062,877 Y193C probably damaging Het
Dgke T A 11: 89,050,685 D288V probably damaging Het
Dst T A 1: 34,208,558 L1683* probably null Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
E130116L18Rik G T 5: 25,223,020 probably benign Het
Eif2b5 G A 16: 20,501,398 V115I possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fgfr3 A T 5: 33,730,038 T234S probably damaging Het
Gipc2 A T 3: 152,102,662 D251E possibly damaging Het
Gm11787 A C 4: 3,511,810 noncoding transcript Het
Gm5538 A C 3: 59,752,028 T301P probably damaging Het
Haus6 A G 4: 86,583,178 Y819H possibly damaging Het
Homez G A 14: 54,858,074 A59V probably damaging Het
Iffo1 T C 6: 125,152,460 V363A probably benign Het
Ifit2 T A 19: 34,574,396 D445E probably benign Het
Ipo9 A C 1: 135,389,606 probably benign Het
Kcnv1 C T 15: 45,113,244 G216R probably damaging Het
Kdm6b A C 11: 69,401,904 probably benign Het
Mplkip T C 13: 17,695,719 S79P probably damaging Het
Nae1 T C 8: 104,523,144 probably benign Het
Nfe2l2 A T 2: 75,676,009 N582K possibly damaging Het
Nsmce4a G A 7: 130,537,024 R297C probably damaging Het
Olfr397 T C 11: 73,964,806 L66P probably damaging Het
Olfr411 T A 11: 74,347,242 D114V probably damaging Het
Olfr495 A T 7: 108,395,702 D194V probably damaging Het
Osbp T A 19: 11,978,290 F357I probably damaging Het
Pcdhb4 A G 18: 37,309,926 D763G possibly damaging Het
Pcdhgb2 A C 18: 37,691,050 I365L possibly damaging Het
Pde6g A G 11: 120,448,086 probably benign Het
Pigo C A 4: 43,020,675 V756L possibly damaging Het
Pkhd1 G T 1: 20,275,641 T2721K probably benign Het
Pls1 A T 9: 95,776,622 probably null Het
Prim2 A G 1: 33,480,316 probably benign Het
Prkd2 T A 7: 16,855,786 I471N probably benign Het
Prrc2b C T 2: 32,206,396 T593I probably benign Het
Ptch2 C A 4: 117,106,138 probably benign Het
Pth A T 7: 113,385,844 D107E probably damaging Het
Pycr2 A C 1: 180,907,623 Q315P probably benign Het
Ripk4 C A 16: 97,743,767 R560L probably damaging Het
Sdr42e1 T C 8: 117,663,282 R207G probably benign Het
Sipa1l1 A G 12: 82,341,588 Y196C possibly damaging Het
Smarcc2 T C 10: 128,481,006 probably null Het
Stom T A 2: 35,336,877 I15F probably benign Het
Sugp2 G T 8: 70,243,275 L299F probably benign Het
Tbrg4 A T 11: 6,617,516 probably null Het
Tkt G T 14: 30,565,678 G210C probably damaging Het
Tmem163 G A 1: 127,491,552 probably benign Het
Trip12 A G 1: 84,794,133 I98T probably benign Het
Unc5b A G 10: 60,774,640 I466T probably damaging Het
Unc79 T A 12: 103,070,751 F599L probably damaging Het
Vav1 G A 17: 57,297,122 E151K probably damaging Het
Vcan T G 13: 89,692,532 D1631A probably benign Het
Vmn2r4 A C 3: 64,406,937 S208A possibly damaging Het
Zfp619 A G 7: 39,537,218 T891A possibly damaging Het
Zfp672 A G 11: 58,329,701 probably benign Het
Znhit1 T A 5: 136,982,381 probably null Het
Other mutations in Rbpj
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01895:Rbpj APN 5 53651386 missense probably damaging 1.00
IGL02537:Rbpj APN 5 53642143 missense probably damaging 1.00
R0676:Rbpj UTSW 5 53646048 splice site probably benign
R2372:Rbpj UTSW 5 53642195 splice site probably benign
R3814:Rbpj UTSW 5 53653172 nonsense probably null
R4153:Rbpj UTSW 5 53649447 missense probably damaging 1.00
R5023:Rbpj UTSW 5 53649415 missense probably damaging 1.00
R5341:Rbpj UTSW 5 53642083 missense possibly damaging 0.71
R6088:Rbpj UTSW 5 53651368 unclassified probably null
R6885:Rbpj UTSW 5 53653151 missense probably damaging 1.00
R7493:Rbpj UTSW 5 53600934 missense probably benign 0.19
R7653:Rbpj UTSW 5 53590351 start codon destroyed probably null
R7703:Rbpj UTSW 5 53645898 missense probably damaging 1.00
R7893:Rbpj UTSW 5 53645874 missense probably damaging 1.00
R7976:Rbpj UTSW 5 53645874 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGCCACCAGAATCTGTTTG -3'
(R):5'- GGAAACAGACCAATGGTTATCC -3'

Sequencing Primer
(F):5'- GCCACCAGAATCTGTTTGTTATTTG -3'
(R):5'- AACAGACCAATGGTTATCCTTTAAG -3'
Posted On2016-07-06