Incidental Mutation 'R1820:Chac2'
ID204798
Institutional Source Beutler Lab
Gene Symbol Chac2
Ensembl Gene ENSMUSG00000020309
Gene NameChaC, cation transport regulator 2
Synonyms
MMRRC Submission 039848-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R1820 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location30976707-30986350 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30977496 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 141 (N141I)
Ref Sequence ENSEMBL: ENSMUSP00000098942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020551] [ENSMUST00000020553] [ENSMUST00000101394] [ENSMUST00000117883] [ENSMUST00000137306] [ENSMUST00000203878]
Predicted Effect probably benign
Transcript: ENSMUST00000020551
SMART Domains Protein: ENSMUSP00000020551
Gene: ENSMUSG00000020305

DomainStartEndE-ValueType
ANK 9 38 5.29e0 SMART
ANK 42 71 1.23e0 SMART
ANK 78 107 7.3e-3 SMART
ANK 111 140 2.66e-5 SMART
ANK 145 174 2.73e-2 SMART
ANK 178 207 2.81e-4 SMART
ANK 211 240 1.88e-5 SMART
ANK 246 276 1.6e2 SMART
ANK 279 308 1.9e-1 SMART
ANK 315 346 1.17e2 SMART
SOCS_box 460 502 2.1e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000020553
AA Change: N129I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020553
Gene: ENSMUSG00000020309
AA Change: N129I

DomainStartEndE-ValueType
Pfam:ChaC 1 162 2.2e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101394
AA Change: N141I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098942
Gene: ENSMUSG00000020309
AA Change: N141I

DomainStartEndE-ValueType
Pfam:ChaC 1 174 5.9e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117883
SMART Domains Protein: ENSMUSP00000113072
Gene: ENSMUSG00000020305

DomainStartEndE-ValueType
ANK 9 38 5.29e0 SMART
ANK 42 71 1.23e0 SMART
ANK 78 107 7.3e-3 SMART
ANK 111 140 2.66e-5 SMART
ANK 145 174 2.73e-2 SMART
ANK 178 207 2.81e-4 SMART
ANK 211 240 1.88e-5 SMART
ANK 246 276 1.6e2 SMART
ANK 279 308 1.9e-1 SMART
ANK 315 346 1.17e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137306
SMART Domains Protein: ENSMUSP00000114692
Gene: ENSMUSG00000020305

DomainStartEndE-ValueType
ANK 9 38 5.29e0 SMART
ANK 42 71 4.3e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148163
Predicted Effect probably benign
Transcript: ENSMUST00000203878
SMART Domains Protein: ENSMUSP00000144900
Gene: ENSMUSG00000020305

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
ANK 48 77 3.5e-2 SMART
ANK 81 110 8e-3 SMART
ANK 117 146 4.8e-5 SMART
ANK 150 179 1.7e-7 SMART
ANK 184 213 1.8e-4 SMART
ANK 217 246 1.8e-6 SMART
ANK 250 279 1.2e-7 SMART
ANK 285 315 1.1e0 SMART
ANK 318 347 1.2e-3 SMART
ANK 354 385 7.7e-1 SMART
SOCS 493 542 2.8e-4 SMART
SOCS_box 499 541 1.6e-17 SMART
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a gamma-glutamyl cyclotransferase that catalyzes the conversion of glutathione to 5-oxoproline and cysteinylglycine. It is thought that this gene is upregulated in response to endoplasmic reticulum stress and that the glutathione depletion enhances apoptosis. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,269,645 K3106E unknown Het
2700049A03Rik T C 12: 71,150,244 V197A possibly damaging Het
9230109A22Rik T C 15: 25,139,090 noncoding transcript Het
Acbd3 A G 1: 180,745,138 N321S probably benign Het
Actr3b T C 5: 25,849,158 probably null Het
Aldh5a1 T C 13: 24,927,572 D124G probably benign Het
Arhgap35 G A 7: 16,561,949 R1064W possibly damaging Het
Arhgef9 T A X: 95,081,536 I225F probably damaging Het
Arl16 T C 11: 120,466,761 T43A probably damaging Het
Camsap3 T C 8: 3,603,485 W409R probably damaging Het
Cfap43 T A 19: 47,897,216 H320L probably damaging Het
Chtf18 C A 17: 25,725,939 G211C probably damaging Het
Cwf19l1 T A 19: 44,127,387 Y201F probably benign Het
Dcun1d1 A T 3: 35,919,004 L114* probably null Het
Fam160a1 T A 3: 85,665,829 T938S probably damaging Het
Fdps A T 3: 89,095,043 H249Q probably benign Het
Gabrg1 T A 5: 70,774,413 Y329F probably damaging Het
Kctd8 T A 5: 69,340,341 I321F probably damaging Het
Kdm5b G T 1: 134,597,670 R299L possibly damaging Het
Kif23 T C 9: 61,926,438 T494A possibly damaging Het
Kmt2e A G 5: 23,473,547 H208R probably damaging Het
Lipo5 A T 19: 33,464,595 probably null Het
Lrrc28 G T 7: 67,641,111 T54K probably damaging Het
Luc7l2 G A 6: 38,598,819 probably null Het
Man2a2 A G 7: 80,358,933 F899L probably benign Het
Myo9b T C 8: 71,333,358 I633T probably damaging Het
Nynrin A T 14: 55,870,378 I981F possibly damaging Het
Olfr262 A T 19: 12,241,248 S138T probably damaging Het
Olfr945 A G 9: 39,258,399 I91T possibly damaging Het
Pank1 A G 19: 34,877,684 probably null Het
Phc2 C T 4: 128,743,543 A47V probably damaging Het
Plekhs1 A G 19: 56,478,522 R262G possibly damaging Het
Pnp2 C A 14: 50,964,457 P300Q possibly damaging Het
Polq T A 16: 37,029,418 S345T possibly damaging Het
Prag1 A G 8: 36,103,804 T514A probably benign Het
Psmd5 T C 2: 34,870,746 probably null Het
Rfx6 T G 10: 51,723,125 probably null Het
Rhbdd2 G A 5: 135,636,049 C78Y probably damaging Het
Rnf157 G T 11: 116,354,651 P313T probably damaging Het
Ryr2 A G 13: 11,587,316 L4560P probably damaging Het
Scai A T 2: 39,106,978 M268K possibly damaging Het
Scd3 A T 19: 44,241,806 T343S probably benign Het
Scimp A T 11: 70,791,597 S98T probably benign Het
Sfrp2 A G 3: 83,773,154 N207S probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sis T C 3: 72,921,142 Y1200C probably damaging Het
Sp1 T A 15: 102,409,076 S343R possibly damaging Het
Spata31d1a A T 13: 59,701,255 C1020S possibly damaging Het
Spink5 A G 18: 43,989,419 N317S possibly damaging Het
Sptbn2 A G 19: 4,726,596 D224G probably damaging Het
St8sia3 T C 18: 64,269,632 I114T probably damaging Het
Zscan5b C A 7: 6,239,163 H460Q probably damaging Het
Other mutations in Chac2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00956:Chac2 APN 11 30986225 missense probably damaging 1.00
IGL02486:Chac2 APN 11 30977625 missense probably damaging 1.00
IGL03386:Chac2 APN 11 30977720 missense probably benign 0.30
IGL02837:Chac2 UTSW 11 30977496 missense probably damaging 1.00
R1832:Chac2 UTSW 11 30977568 missense probably benign 0.00
R2319:Chac2 UTSW 11 30986252 intron probably benign
R6084:Chac2 UTSW 11 30986159 missense probably damaging 1.00
R6348:Chac2 UTSW 11 30977406 missense probably damaging 0.98
R6500:Chac2 UTSW 11 30977625 missense probably damaging 1.00
R8340:Chac2 UTSW 11 30977511 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAAAACTCTTGCCTCTTTGGG -3'
(R):5'- GGTGTTGCTTACAAACTACCAG -3'

Sequencing Primer
(F):5'- GTGCGTTGGTGACTCTGTATGC -3'
(R):5'- CATACCTTGACTTCAGAGAGAAAGG -3'
Posted On2014-06-23