Incidental Mutation 'R1820:Phc2'
ID204774
Institutional Source Beutler Lab
Gene Symbol Phc2
Ensembl Gene ENSMUSG00000028796
Gene Namepolyhomeotic 2
SynonymsEdr2, D4Ertd810e, Mph2, D130050K19Rik
MMRRC Submission 039848-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1820 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location128654702-128752881 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 128743543 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 47 (A47V)
Ref Sequence ENSEMBL: ENSMUSP00000123307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030588] [ENSMUST00000106079] [ENSMUST00000106080] [ENSMUST00000120946] [ENSMUST00000133439] [ENSMUST00000134421] [ENSMUST00000138445] [ENSMUST00000143632] [ENSMUST00000147572]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030588
AA Change: A574V

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030588
Gene: ENSMUSG00000028796
AA Change: A574V

DomainStartEndE-ValueType
low complexity region 15 41 N/A INTRINSIC
low complexity region 74 119 N/A INTRINSIC
low complexity region 126 152 N/A INTRINSIC
low complexity region 232 248 N/A INTRINSIC
low complexity region 257 269 N/A INTRINSIC
low complexity region 343 367 N/A INTRINSIC
low complexity region 487 499 N/A INTRINSIC
low complexity region 529 543 N/A INTRINSIC
Pfam:PHC2_SAM_assoc 662 781 2.6e-55 PFAM
SAM 783 850 8.53e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106079
AA Change: A47V

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101689
Gene: ENSMUSG00000028796
AA Change: A47V

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDB:2L8E|A 105 135 1e-6 PDB
low complexity region 216 228 N/A INTRINSIC
SAM 256 323 8.53e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106080
AA Change: A574V

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101690
Gene: ENSMUSG00000028796
AA Change: A574V

DomainStartEndE-ValueType
low complexity region 15 41 N/A INTRINSIC
low complexity region 74 119 N/A INTRINSIC
low complexity region 126 152 N/A INTRINSIC
low complexity region 232 248 N/A INTRINSIC
low complexity region 257 269 N/A INTRINSIC
low complexity region 343 367 N/A INTRINSIC
low complexity region 487 499 N/A INTRINSIC
low complexity region 529 543 N/A INTRINSIC
PDB:2L8E|A 632 662 4e-7 PDB
low complexity region 743 755 N/A INTRINSIC
SAM 783 850 8.53e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120946
Predicted Effect unknown
Transcript: ENSMUST00000133439
AA Change: A47V
SMART Domains Protein: ENSMUSP00000117163
Gene: ENSMUSG00000028796
AA Change: A47V

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000134421
AA Change: A47V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123307
Gene: ENSMUSG00000028796
AA Change: A47V

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDB:2L8E|A 105 135 6e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000138445
Predicted Effect probably benign
Transcript: ENSMUST00000143632
Predicted Effect possibly damaging
Transcript: ENSMUST00000147572
AA Change: A47V

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000118298
Gene: ENSMUSG00000028796
AA Change: A47V

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDB:2L8E|A 105 135 8e-7 PDB
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In Drosophila melanogaster, the 'Polycomb' group (PcG) of genes are part of a cellular memory system that is responsible for the stable inheritance of gene activity. PcG proteins form a large multimeric, chromatin-associated protein complex. The protein encoded by this gene has homology to the Drosophila PcG protein 'polyhomeotic' (Ph) and is known to heterodimerize with EDR1 and colocalize with BMI1 in interphase nuclei of human cells. The specific function in human cells has not yet been determined. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele have normal skulls but exhibit posterior homeotic transformations of the axial skeleton. Cultured mouse embryonic fibroblasts show defects in proliferation and premature senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,269,645 K3106E unknown Het
2700049A03Rik T C 12: 71,150,244 V197A possibly damaging Het
9230109A22Rik T C 15: 25,139,090 noncoding transcript Het
Acbd3 A G 1: 180,745,138 N321S probably benign Het
Actr3b T C 5: 25,849,158 probably null Het
Aldh5a1 T C 13: 24,927,572 D124G probably benign Het
Arhgap35 G A 7: 16,561,949 R1064W possibly damaging Het
Arhgef9 T A X: 95,081,536 I225F probably damaging Het
Arl16 T C 11: 120,466,761 T43A probably damaging Het
Camsap3 T C 8: 3,603,485 W409R probably damaging Het
Cfap43 T A 19: 47,897,216 H320L probably damaging Het
Chac2 T A 11: 30,977,496 N141I probably damaging Het
Chtf18 C A 17: 25,725,939 G211C probably damaging Het
Cwf19l1 T A 19: 44,127,387 Y201F probably benign Het
Dcun1d1 A T 3: 35,919,004 L114* probably null Het
Fam160a1 T A 3: 85,665,829 T938S probably damaging Het
Fdps A T 3: 89,095,043 H249Q probably benign Het
Gabrg1 T A 5: 70,774,413 Y329F probably damaging Het
Kctd8 T A 5: 69,340,341 I321F probably damaging Het
Kdm5b G T 1: 134,597,670 R299L possibly damaging Het
Kif23 T C 9: 61,926,438 T494A possibly damaging Het
Kmt2e A G 5: 23,473,547 H208R probably damaging Het
Lipo5 A T 19: 33,464,595 probably null Het
Lrrc28 G T 7: 67,641,111 T54K probably damaging Het
Luc7l2 G A 6: 38,598,819 probably null Het
Man2a2 A G 7: 80,358,933 F899L probably benign Het
Myo9b T C 8: 71,333,358 I633T probably damaging Het
Nynrin A T 14: 55,870,378 I981F possibly damaging Het
Olfr262 A T 19: 12,241,248 S138T probably damaging Het
Olfr945 A G 9: 39,258,399 I91T possibly damaging Het
Pank1 A G 19: 34,877,684 probably null Het
Plekhs1 A G 19: 56,478,522 R262G possibly damaging Het
Pnp2 C A 14: 50,964,457 P300Q possibly damaging Het
Polq T A 16: 37,029,418 S345T possibly damaging Het
Prag1 A G 8: 36,103,804 T514A probably benign Het
Psmd5 T C 2: 34,870,746 probably null Het
Rfx6 T G 10: 51,723,125 probably null Het
Rhbdd2 G A 5: 135,636,049 C78Y probably damaging Het
Rnf157 G T 11: 116,354,651 P313T probably damaging Het
Ryr2 A G 13: 11,587,316 L4560P probably damaging Het
Scai A T 2: 39,106,978 M268K possibly damaging Het
Scd3 A T 19: 44,241,806 T343S probably benign Het
Scimp A T 11: 70,791,597 S98T probably benign Het
Sfrp2 A G 3: 83,773,154 N207S probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sis T C 3: 72,921,142 Y1200C probably damaging Het
Sp1 T A 15: 102,409,076 S343R possibly damaging Het
Spata31d1a A T 13: 59,701,255 C1020S possibly damaging Het
Spink5 A G 18: 43,989,419 N317S possibly damaging Het
Sptbn2 A G 19: 4,726,596 D224G probably damaging Het
St8sia3 T C 18: 64,269,632 I114T probably damaging Het
Zscan5b C A 7: 6,239,163 H460Q probably damaging Het
Other mutations in Phc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00727:Phc2 APN 4 128745844 missense probably damaging 1.00
IGL01470:Phc2 APN 4 128723110 missense probably benign 0.00
IGL02171:Phc2 APN 4 128711065 missense probably damaging 1.00
IGL02884:Phc2 APN 4 128708016 missense probably damaging 1.00
I1329:Phc2 UTSW 4 128711113 missense probably damaging 0.98
PIT4696001:Phc2 UTSW 4 128705202 missense probably damaging 1.00
R0483:Phc2 UTSW 4 128723307 unclassified probably benign
R0625:Phc2 UTSW 4 128723710 missense possibly damaging 0.80
R1392:Phc2 UTSW 4 128745087 missense possibly damaging 0.63
R1392:Phc2 UTSW 4 128745087 missense possibly damaging 0.63
R1429:Phc2 UTSW 4 128743555 missense probably damaging 1.00
R1701:Phc2 UTSW 4 128751607 missense probably damaging 1.00
R2011:Phc2 UTSW 4 128723585 missense probably benign 0.27
R2063:Phc2 UTSW 4 128747136 missense probably damaging 1.00
R2064:Phc2 UTSW 4 128747136 missense probably damaging 1.00
R2065:Phc2 UTSW 4 128747136 missense probably damaging 1.00
R2066:Phc2 UTSW 4 128747136 missense probably damaging 1.00
R2067:Phc2 UTSW 4 128747136 missense probably damaging 1.00
R2152:Phc2 UTSW 4 128745066 makesense probably null
R2375:Phc2 UTSW 4 128723025 missense probably benign
R2430:Phc2 UTSW 4 128707983 missense probably damaging 1.00
R3910:Phc2 UTSW 4 128743558 critical splice donor site probably null
R3911:Phc2 UTSW 4 128743558 critical splice donor site probably null
R3941:Phc2 UTSW 4 128747244 critical splice donor site probably null
R4108:Phc2 UTSW 4 128707983 missense probably damaging 1.00
R4585:Phc2 UTSW 4 128743510 missense probably damaging 1.00
R4731:Phc2 UTSW 4 128707971 missense probably damaging 1.00
R4801:Phc2 UTSW 4 128751598 missense probably damaging 1.00
R4802:Phc2 UTSW 4 128751598 missense probably damaging 1.00
R4948:Phc2 UTSW 4 128723115 missense probably benign 0.00
R5498:Phc2 UTSW 4 128708994 missense probably benign 0.37
R5712:Phc2 UTSW 4 128745095 missense probably damaging 1.00
R5742:Phc2 UTSW 4 128745868 missense probably damaging 1.00
R6272:Phc2 UTSW 4 128709647 missense probably damaging 1.00
R6298:Phc2 UTSW 4 128748189 missense possibly damaging 0.91
R6348:Phc2 UTSW 4 128705151 missense probably benign 0.00
R6630:Phc2 UTSW 4 128723630 missense probably damaging 0.97
R6925:Phc2 UTSW 4 128748134 missense probably damaging 1.00
R7067:Phc2 UTSW 4 128747141 missense probably benign 0.02
R7396:Phc2 UTSW 4 128748161 missense probably benign 0.21
R7585:Phc2 UTSW 4 128711139 missense probably benign 0.35
R7590:Phc2 UTSW 4 128748027 missense probably damaging 1.00
R7723:Phc2 UTSW 4 128723089 missense probably benign 0.33
R7949:Phc2 UTSW 4 128709608 missense probably damaging 0.97
R7995:Phc2 UTSW 4 128709608 missense probably damaging 0.97
R8053:Phc2 UTSW 4 128709640 nonsense probably null
R8078:Phc2 UTSW 4 128711062 missense probably damaging 1.00
R8209:Phc2 UTSW 4 128709506 missense probably benign 0.03
R8331:Phc2 UTSW 4 128712194 nonsense probably null
X0012:Phc2 UTSW 4 128709052 missense probably damaging 0.99
X0017:Phc2 UTSW 4 128723272 missense probably damaging 0.99
X0023:Phc2 UTSW 4 128708043 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CATTGTTCATGCACTGACCG -3'
(R):5'- CAAGGGGTCTTGTCTTATCAATTAGC -3'

Sequencing Primer
(F):5'- TTCATGCACTGACCGACCTCAG -3'
(R):5'- GGAAGAACAAACTGTTCACAT -3'
Posted On2014-06-23