Incidental Mutation 'R1826:Pcdhb5'
ID206860
Institutional Source Beutler Lab
Gene Symbol Pcdhb5
Ensembl Gene ENSMUSG00000063687
Gene Nameprotocadherin beta 5
SynonymsPcdhb4A, PcdhbE
MMRRC Submission 039853-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R1826 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37320381-37323915 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 37321469 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 301 (R301*)
Ref Sequence ENSEMBL: ENSMUSP00000077389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078271] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably null
Transcript: ENSMUST00000078271
AA Change: R301*
SMART Domains Protein: ENSMUSP00000077389
Gene: ENSMUSG00000063687
AA Change: R301*

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 46 130 1.55e0 SMART
CA 154 239 2.42e-18 SMART
CA 263 344 1.27e-26 SMART
CA 367 448 1.14e-23 SMART
CA 472 558 2.38e-26 SMART
CA 588 669 7.06e-11 SMART
Pfam:Cadherin_C_2 686 769 3.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.0%
Validation Efficiency 95% (116/122)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T C 19: 43,822,014 S917P probably benign Het
Acsbg1 C T 9: 54,622,556 V256M possibly damaging Het
Adam34 T A 8: 43,651,342 D422V probably damaging Het
Adam6a T A 12: 113,546,122 V705E possibly damaging Het
Adamts12 C A 15: 11,071,520 P50Q probably benign Het
Arfgap3 C T 15: 83,303,102 probably null Het
Aspg T A 12: 112,123,418 D463E probably damaging Het
Atad2b G A 12: 4,974,094 S73N probably benign Het
Atp11a T C 8: 12,846,154 L788P probably damaging Het
B3gnt8 T C 7: 25,628,763 F206S probably damaging Het
Baz2b T C 2: 59,968,733 E349G probably benign Het
Bmp2k A T 5: 97,061,402 probably benign Het
Camta2 A G 11: 70,683,308 F128L probably damaging Het
Ccdc88a A T 11: 29,489,637 Q30L possibly damaging Het
Cdh1 T C 8: 106,666,266 M794T probably benign Het
Cdh5 A G 8: 104,131,091 N383S possibly damaging Het
Cep85l T C 10: 53,348,812 D227G possibly damaging Het
Clec4e A G 6: 123,283,632 S156P probably damaging Het
Col10a1 G T 10: 34,394,649 G206C probably damaging Het
Col4a2 T C 8: 11,313,509 probably null Het
Copg2 A G 6: 30,812,842 M517T probably benign Het
Cyp2f2 T A 7: 27,132,562 L414Q probably damaging Het
Dact1 G A 12: 71,318,344 G596D probably damaging Het
Dcaf13 T C 15: 39,118,899 C87R probably damaging Het
Dchs1 T G 7: 105,757,627 T2224P probably damaging Het
Dnah12 A G 14: 26,711,019 M429V probably benign Het
Dppa2 G A 16: 48,317,348 R231H probably damaging Het
Elavl4 T C 4: 110,251,292 D78G probably damaging Het
Enthd1 T C 15: 80,474,281 E346G probably damaging Het
Exoc3l A T 8: 105,293,618 I225N probably damaging Het
Fam208b T A 13: 3,581,759 N914I probably damaging Het
Fasn C T 11: 120,808,499 probably benign Het
Fbxl7 G A 15: 26,552,765 R139C possibly damaging Het
Fbxw15 C A 9: 109,559,714 probably null Het
Flnc A G 6: 29,455,185 T1971A probably damaging Het
Fnip1 T G 11: 54,466,164 V33G probably damaging Het
Foxn2 A G 17: 88,486,805 E390G possibly damaging Het
Fry C T 5: 150,436,709 S1940L possibly damaging Het
Fzd3 A T 14: 65,253,106 D9E probably benign Het
Gabrd T C 4: 155,386,486 Y255C probably damaging Het
Garem1 A T 18: 21,129,452 F768L probably benign Het
Gas2 T A 7: 51,943,673 L167Q probably damaging Het
Gm16391 A G 17: 76,284,423 noncoding transcript Het
Gm1979 A T 5: 26,001,242 N113K probably damaging Het
Gm5751 T A X: 8,880,705 Y133* probably null Het
Gpr83 G T 9: 14,868,333 C269F possibly damaging Het
Hdac4 T A 1: 91,984,699 N352Y probably damaging Het
Hdac9 A G 12: 34,429,492 probably benign Het
Hhipl2 G A 1: 183,436,344 S673N probably benign Het
Iffo2 T A 4: 139,614,065 S417T probably benign Het
Itgb5 G T 16: 33,865,560 R90L possibly damaging Het
Jade1 T G 3: 41,613,213 L572W probably damaging Het
Kcnh1 T A 1: 192,413,068 M478K possibly damaging Het
Kcnma1 C A 14: 23,330,929 D903Y probably damaging Het
Kcnq4 T A 4: 120,704,504 H456L probably benign Het
Kif9 C A 9: 110,517,633 T613K probably benign Het
Krt36 T G 11: 100,103,030 probably benign Het
Kyat3 A T 3: 142,723,179 D89V possibly damaging Het
Lnpep A T 17: 17,562,836 F568I probably damaging Het
Lpl T C 8: 68,902,291 F444L possibly damaging Het
Lrp1 A T 10: 127,553,707 V3153E probably damaging Het
Lrrn1 A T 6: 107,567,568 N109I probably benign Het
Ltn1 A G 16: 87,415,616 Y686H probably damaging Het
Mcoln2 A C 3: 146,175,472 D166A possibly damaging Het
Ms4a6b A T 19: 11,523,934 I103F probably damaging Het
Mtmr10 T G 7: 64,337,466 S585A probably benign Het
Mx1 T C 16: 97,455,637 N114S possibly damaging Het
Mysm1 A T 4: 94,970,686 N75K probably benign Het
Nkx1-1 A G 5: 33,433,933 V15A unknown Het
Nlrp1a T A 11: 71,107,980 probably benign Het
Nlrp1a G A 11: 71,122,747 T559I possibly damaging Het
Oas1f A G 5: 120,855,589 K288R probably benign Het
Olfr1494 T A 19: 13,749,347 D80E probably benign Het
Olfr311 T A 11: 58,841,431 C106S probably benign Het
Olfr543 A G 7: 102,477,513 L119P probably damaging Het
Pcdhb2 T A 18: 37,295,985 V337D probably damaging Het
Phf12 T C 11: 78,024,954 probably benign Het
Pik3c2a C T 7: 116,368,117 D862N probably benign Het
Pkhd1l1 T A 15: 44,503,345 L740I possibly damaging Het
Ppp1r9a A T 6: 5,111,060 probably benign Het
Prg4 T C 1: 150,452,009 D820G probably benign Het
Prmt9 C T 8: 77,555,674 Q67* probably null Het
Prob1 T C 18: 35,653,575 E542G possibly damaging Het
Pttg1 A G 11: 43,420,366 V188A probably damaging Het
Rassf1 T A 9: 107,558,193 L260H probably damaging Het
Rbm5 T A 9: 107,742,414 Q766L probably damaging Het
Rbms3 T A 9: 116,822,868 Y137F probably damaging Het
Rccd1 T C 7: 80,320,218 probably benign Het
Rnf182 G A 13: 43,668,534 W187* probably null Het
S100a11 A T 3: 93,526,121 I91F probably benign Het
Setd4 T A 16: 93,591,299 K100* probably null Het
Simc1 T A 13: 54,524,639 C267S probably benign Het
Slc16a1 G T 3: 104,650,939 A91S probably benign Het
Slc36a1 A G 11: 55,220,453 N133S probably benign Het
Svil C T 18: 5,063,383 P885S probably benign Het
Svop A T 5: 114,060,056 probably null Het
Taar7d T C 10: 24,027,576 Y119H probably damaging Het
Tgfb3 T C 12: 86,062,044 T304A probably benign Het
Tmem94 C A 11: 115,793,213 C786* probably null Het
Tnfrsf4 T A 4: 156,016,279 probably null Het
Tns1 C A 1: 73,953,634 M1I probably null Het
Trappc13 C T 13: 104,169,819 probably null Het
Trim72 T C 7: 128,007,844 F182L possibly damaging Het
Ttc6 T C 12: 57,660,247 S647P probably benign Het
Tulp1 A G 17: 28,356,367 L400P possibly damaging Het
Vegfc C T 8: 54,181,312 T342M possibly damaging Het
Vit T A 17: 78,534,676 V15E probably benign Het
Vps13d A T 4: 145,155,003 M1334K probably damaging Het
Zfp280d T C 9: 72,298,780 V23A probably damaging Het
Zfp608 A G 18: 54,898,576 I764T probably benign Het
Zfp94 T C 7: 24,309,115 Y33C probably damaging Het
Zfyve26 T A 12: 79,269,049 I1218F probably damaging Het
Other mutations in Pcdhb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Pcdhb5 APN 18 37322109 missense probably damaging 1.00
IGL00895:Pcdhb5 APN 18 37320983 missense probably benign 0.42
IGL00896:Pcdhb5 APN 18 37322785 intron probably null
IGL01385:Pcdhb5 APN 18 37322214 missense probably benign 0.00
IGL01619:Pcdhb5 APN 18 37322939 missense probably damaging 1.00
IGL01712:Pcdhb5 APN 18 37321253 missense probably damaging 1.00
IGL01716:Pcdhb5 APN 18 37321022 missense probably benign
IGL01719:Pcdhb5 APN 18 37321022 missense probably benign
IGL01720:Pcdhb5 APN 18 37321022 missense probably benign
IGL01723:Pcdhb5 APN 18 37321022 missense probably benign
IGL01724:Pcdhb5 APN 18 37321022 missense probably benign
IGL01839:Pcdhb5 APN 18 37321449 missense probably damaging 0.98
IGL01884:Pcdhb5 APN 18 37321334 missense probably benign 0.00
IGL01962:Pcdhb5 APN 18 37321040 missense probably damaging 1.00
IGL02088:Pcdhb5 APN 18 37321959 missense probably benign 0.11
IGL02299:Pcdhb5 APN 18 37320890 missense probably benign
IGL02444:Pcdhb5 APN 18 37321050 missense probably benign 0.01
IGL03372:Pcdhb5 APN 18 37320660 missense probably benign 0.22
R0034:Pcdhb5 UTSW 18 37322084 missense probably damaging 1.00
R0047:Pcdhb5 UTSW 18 37321268 missense possibly damaging 0.87
R0179:Pcdhb5 UTSW 18 37322559 missense probably damaging 1.00
R0466:Pcdhb5 UTSW 18 37322543 missense probably damaging 1.00
R0471:Pcdhb5 UTSW 18 37321306 nonsense probably null
R0565:Pcdhb5 UTSW 18 37320767 missense possibly damaging 0.91
R0646:Pcdhb5 UTSW 18 37321622 missense probably benign
R1014:Pcdhb5 UTSW 18 37322250 missense probably damaging 1.00
R1617:Pcdhb5 UTSW 18 37321402 nonsense probably null
R1676:Pcdhb5 UTSW 18 37320752 missense probably benign 0.01
R1774:Pcdhb5 UTSW 18 37322672 missense probably damaging 0.99
R1854:Pcdhb5 UTSW 18 37322340 missense possibly damaging 0.94
R2355:Pcdhb5 UTSW 18 37322116 missense probably benign
R4290:Pcdhb5 UTSW 18 37322681 missense possibly damaging 0.90
R4292:Pcdhb5 UTSW 18 37322681 missense possibly damaging 0.90
R4293:Pcdhb5 UTSW 18 37322681 missense possibly damaging 0.90
R4294:Pcdhb5 UTSW 18 37322681 missense possibly damaging 0.90
R4295:Pcdhb5 UTSW 18 37322681 missense possibly damaging 0.90
R4391:Pcdhb5 UTSW 18 37322736 missense possibly damaging 0.88
R4411:Pcdhb5 UTSW 18 37321997 missense possibly damaging 0.80
R4480:Pcdhb5 UTSW 18 37320752 missense probably benign 0.43
R4852:Pcdhb5 UTSW 18 37322471 missense probably benign 0.04
R5121:Pcdhb5 UTSW 18 37321117 missense probably benign 0.11
R5133:Pcdhb5 UTSW 18 37320890 missense probably benign
R5630:Pcdhb5 UTSW 18 37321155 missense possibly damaging 0.88
R5833:Pcdhb5 UTSW 18 37321102 missense probably damaging 0.99
R5896:Pcdhb5 UTSW 18 37322679 nonsense probably null
R5942:Pcdhb5 UTSW 18 37320785 nonsense probably null
R5945:Pcdhb5 UTSW 18 37321470 missense probably benign 0.08
R5970:Pcdhb5 UTSW 18 37321773 missense probably damaging 1.00
R6045:Pcdhb5 UTSW 18 37321575 missense probably damaging 1.00
R6054:Pcdhb5 UTSW 18 37321080 missense probably damaging 0.98
R6147:Pcdhb5 UTSW 18 37320726 missense probably damaging 1.00
R6152:Pcdhb5 UTSW 18 37322833 nonsense probably null
R6193:Pcdhb5 UTSW 18 37322027 missense probably damaging 1.00
R6397:Pcdhb5 UTSW 18 37321505 missense probably benign 0.08
R6505:Pcdhb5 UTSW 18 37320880 missense probably benign 0.00
R6608:Pcdhb5 UTSW 18 37321823 missense probably damaging 0.98
R6737:Pcdhb5 UTSW 18 37322670 missense probably damaging 1.00
R7146:Pcdhb5 UTSW 18 37321356 missense probably damaging 1.00
R7162:Pcdhb5 UTSW 18 37321686 missense probably benign 0.16
R7584:Pcdhb5 UTSW 18 37322372 missense possibly damaging 0.90
R8214:Pcdhb5 UTSW 18 37321583 missense probably benign 0.37
R8327:Pcdhb5 UTSW 18 37320900 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATCAATGACAATGCTCCTGAG -3'
(R):5'- GATAGCGACCACAGTTTCTGG -3'

Sequencing Primer
(F):5'- GTTTGTGAACAACCCCTATGAGG -3'
(R):5'- GCGACCACAGTTTCTGGAGAATTTTC -3'
Posted On2014-06-23