Incidental Mutation 'R4480:Pcdhb5'
ID331450
Institutional Source Beutler Lab
Gene Symbol Pcdhb5
Ensembl Gene ENSMUSG00000063687
Gene Nameprotocadherin beta 5
SynonymsPcdhb4A, PcdhbE
MMRRC Submission 041737-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R4480 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37320381-37323915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37320752 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 62 (S62T)
Ref Sequence ENSEMBL: ENSMUSP00000077389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078271] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000078271
AA Change: S62T

PolyPhen 2 Score 0.429 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000077389
Gene: ENSMUSG00000063687
AA Change: S62T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 46 130 1.55e0 SMART
CA 154 239 2.42e-18 SMART
CA 263 344 1.27e-26 SMART
CA 367 448 1.14e-23 SMART
CA 472 558 2.38e-26 SMART
CA 588 669 7.06e-11 SMART
Pfam:Cadherin_C_2 686 769 3.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.3780 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,005,239 T553A possibly damaging Het
Adgrb3 A T 1: 25,111,748 F1135I probably damaging Het
Arfgef3 A T 10: 18,600,600 F1490L probably damaging Het
Begain A G 12: 109,034,123 Y446H probably damaging Het
Cdh15 A G 8: 122,864,676 H517R probably benign Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dip2b C T 15: 100,186,301 T935M probably damaging Het
Eif2s2 T C 2: 154,888,270 T36A probably benign Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fbxo10 T C 4: 45,048,470 Y555C probably damaging Het
Fpr2 C T 17: 17,893,753 T337I probably benign Het
Frem3 A T 8: 80,611,357 Q93L probably benign Het
Gapdh A G 6: 125,163,182 V119A possibly damaging Het
Gm3159 T C 14: 4,398,584 Y92H probably damaging Het
Hkdc1 T C 10: 62,391,372 I769V probably benign Het
Ifne T C 4: 88,879,601 *193W probably null Het
Katna1 T C 10: 7,738,830 V32A probably damaging Het
Nup107 T C 10: 117,761,332 I673V probably benign Het
Nup188 T A 2: 30,322,129 probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1510 G A 14: 52,410,308 A188V probably damaging Het
Olfr330 G T 11: 58,529,801 P62T probably damaging Het
Plekha5 T C 6: 140,526,479 V44A probably damaging Het
Psg18 C T 7: 18,350,862 S103N probably benign Het
Ptprcap A G 19: 4,156,224 E102G probably benign Het
Ptprs A G 17: 56,426,404 V804A possibly damaging Het
Rab35 C A 5: 115,637,764 S34* probably null Het
Slco6d1 T A 1: 98,507,574 Y671* probably null Het
Sostdc1 A G 12: 36,317,166 I114V probably damaging Het
Tecta A G 9: 42,373,233 F852S possibly damaging Het
Tmem179 T C 12: 112,503,303 E21G probably benign Het
Tmem2 A G 19: 21,815,489 Q703R probably benign Het
Usp17la T A 7: 104,860,690 H167Q probably benign Het
Vps8 A T 16: 21,545,236 probably benign Het
Wdr17 A G 8: 54,664,964 probably null Het
Wdr73 T C 7: 80,893,221 E213G probably benign Het
Zfp985 A G 4: 147,584,079 D468G probably benign Het
Other mutations in Pcdhb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Pcdhb5 APN 18 37322109 missense probably damaging 1.00
IGL00895:Pcdhb5 APN 18 37320983 missense probably benign 0.42
IGL00896:Pcdhb5 APN 18 37322785 intron probably null
IGL01385:Pcdhb5 APN 18 37322214 missense probably benign 0.00
IGL01619:Pcdhb5 APN 18 37322939 missense probably damaging 1.00
IGL01712:Pcdhb5 APN 18 37321253 missense probably damaging 1.00
IGL01716:Pcdhb5 APN 18 37321022 missense probably benign
IGL01719:Pcdhb5 APN 18 37321022 missense probably benign
IGL01720:Pcdhb5 APN 18 37321022 missense probably benign
IGL01723:Pcdhb5 APN 18 37321022 missense probably benign
IGL01724:Pcdhb5 APN 18 37321022 missense probably benign
IGL01839:Pcdhb5 APN 18 37321449 missense probably damaging 0.98
IGL01884:Pcdhb5 APN 18 37321334 missense probably benign 0.00
IGL01962:Pcdhb5 APN 18 37321040 missense probably damaging 1.00
IGL02088:Pcdhb5 APN 18 37321959 missense probably benign 0.11
IGL02299:Pcdhb5 APN 18 37320890 missense probably benign
IGL02444:Pcdhb5 APN 18 37321050 missense probably benign 0.01
IGL03372:Pcdhb5 APN 18 37320660 missense probably benign 0.22
R0034:Pcdhb5 UTSW 18 37322084 missense probably damaging 1.00
R0047:Pcdhb5 UTSW 18 37321268 missense possibly damaging 0.87
R0179:Pcdhb5 UTSW 18 37322559 missense probably damaging 1.00
R0466:Pcdhb5 UTSW 18 37322543 missense probably damaging 1.00
R0471:Pcdhb5 UTSW 18 37321306 nonsense probably null
R0565:Pcdhb5 UTSW 18 37320767 missense possibly damaging 0.91
R0646:Pcdhb5 UTSW 18 37321622 missense probably benign
R1014:Pcdhb5 UTSW 18 37322250 missense probably damaging 1.00
R1617:Pcdhb5 UTSW 18 37321402 nonsense probably null
R1676:Pcdhb5 UTSW 18 37320752 missense probably benign 0.01
R1774:Pcdhb5 UTSW 18 37322672 missense probably damaging 0.99
R1826:Pcdhb5 UTSW 18 37321469 nonsense probably null
R1854:Pcdhb5 UTSW 18 37322340 missense possibly damaging 0.94
R2355:Pcdhb5 UTSW 18 37322116 missense probably benign
R4290:Pcdhb5 UTSW 18 37322681 missense possibly damaging 0.90
R4292:Pcdhb5 UTSW 18 37322681 missense possibly damaging 0.90
R4293:Pcdhb5 UTSW 18 37322681 missense possibly damaging 0.90
R4294:Pcdhb5 UTSW 18 37322681 missense possibly damaging 0.90
R4295:Pcdhb5 UTSW 18 37322681 missense possibly damaging 0.90
R4391:Pcdhb5 UTSW 18 37322736 missense possibly damaging 0.88
R4411:Pcdhb5 UTSW 18 37321997 missense possibly damaging 0.80
R4852:Pcdhb5 UTSW 18 37322471 missense probably benign 0.04
R5121:Pcdhb5 UTSW 18 37321117 missense probably benign 0.11
R5133:Pcdhb5 UTSW 18 37320890 missense probably benign
R5630:Pcdhb5 UTSW 18 37321155 missense possibly damaging 0.88
R5833:Pcdhb5 UTSW 18 37321102 missense probably damaging 0.99
R5896:Pcdhb5 UTSW 18 37322679 nonsense probably null
R5942:Pcdhb5 UTSW 18 37320785 nonsense probably null
R5945:Pcdhb5 UTSW 18 37321470 missense probably benign 0.08
R5970:Pcdhb5 UTSW 18 37321773 missense probably damaging 1.00
R6045:Pcdhb5 UTSW 18 37321575 missense probably damaging 1.00
R6054:Pcdhb5 UTSW 18 37321080 missense probably damaging 0.98
R6147:Pcdhb5 UTSW 18 37320726 missense probably damaging 1.00
R6152:Pcdhb5 UTSW 18 37322833 nonsense probably null
R6193:Pcdhb5 UTSW 18 37322027 missense probably damaging 1.00
R6397:Pcdhb5 UTSW 18 37321505 missense probably benign 0.08
R6505:Pcdhb5 UTSW 18 37320880 missense probably benign 0.00
R6608:Pcdhb5 UTSW 18 37321823 missense probably damaging 0.98
R6737:Pcdhb5 UTSW 18 37322670 missense probably damaging 1.00
R7146:Pcdhb5 UTSW 18 37321356 missense probably damaging 1.00
R7162:Pcdhb5 UTSW 18 37321686 missense probably benign 0.16
R7584:Pcdhb5 UTSW 18 37322372 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GTTTTCACCATGGAGAAGCTGG -3'
(R):5'- CTGGCGAGTTGTCATTTATATCC -3'

Sequencing Primer
(F):5'- CTGGAGAGAAATCATCGAAACAGGC -3'
(R):5'- CGAGTTGTCATTTATATCCTGGATC -3'
Posted On2015-07-21