Incidental Mutation 'R5970:Pcdhb5'
ID470834
Institutional Source Beutler Lab
Gene Symbol Pcdhb5
Ensembl Gene ENSMUSG00000063687
Gene Nameprotocadherin beta 5
SynonymsPcdhb4A, PcdhbE
MMRRC Submission 044153-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R5970 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37320381-37323915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37321773 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 402 (L402Q)
Ref Sequence ENSEMBL: ENSMUSP00000077389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078271] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably damaging
Transcript: ENSMUST00000078271
AA Change: L402Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077389
Gene: ENSMUSG00000063687
AA Change: L402Q

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 46 130 1.55e0 SMART
CA 154 239 2.42e-18 SMART
CA 263 344 1.27e-26 SMART
CA 367 448 1.14e-23 SMART
CA 472 558 2.38e-26 SMART
CA 588 669 7.06e-11 SMART
Pfam:Cadherin_C_2 686 769 3.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.7507 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l1 G A 6: 90,597,046 probably benign Het
Ambn T C 5: 88,467,951 V413A possibly damaging Het
Amotl1 T A 9: 14,596,528 D41V probably damaging Het
Arhgef26 T C 3: 62,340,047 V184A probably benign Het
Birc6 G T 17: 74,618,502 G936V possibly damaging Het
Ccser1 T A 6: 61,311,242 S130T possibly damaging Het
Cecr2 A G 6: 120,720,907 I56V probably damaging Het
Cfap52 A G 11: 67,930,744 I486T probably damaging Het
Col4a3 A G 1: 82,716,329 I1557V possibly damaging Het
Col6a5 T A 9: 105,945,847 I104F unknown Het
Cry2 A G 2: 92,412,967 S510P probably benign Het
Csmd2 G C 4: 128,546,151 A3133P probably benign Het
Cyld G T 8: 88,732,993 A611S probably damaging Het
Dennd4c G A 4: 86,825,512 G1197E probably damaging Het
Dnah10 T C 5: 124,808,729 F2969L probably benign Het
Dnaic1 A G 4: 41,625,281 K415R probably benign Het
Dnmbp T A 19: 43,854,171 T1253S probably benign Het
Dsp T C 13: 38,195,702 L1542P possibly damaging Het
Duox1 T A 2: 122,340,201 L1234Q probably damaging Het
Efr3b T A 12: 3,968,590 R585S possibly damaging Het
Gpt A G 15: 76,699,352 probably null Het
Heatr6 G A 11: 83,753,718 probably benign Het
Kcns2 A G 15: 34,839,784 D431G probably benign Het
Kdm3b A G 18: 34,829,289 N1543D probably damaging Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Mical3 G A 6: 120,958,271 Q893* probably null Het
Morc3 C T 16: 93,866,453 H515Y possibly damaging Het
Mprip A T 11: 59,757,721 R750S probably damaging Het
Mroh1 G A 15: 76,451,491 V1436M probably benign Het
Muc5ac C T 7: 141,790,669 R69* probably null Het
Muc5b A T 7: 141,856,712 Y1274F unknown Het
Mybpc1 A G 10: 88,542,456 L674P probably damaging Het
Mypn A G 10: 63,131,023 V958A probably benign Het
Nipbl T C 15: 8,296,818 T2436A probably benign Het
Olfr835 A G 9: 19,035,147 D8G probably benign Het
Pigp T A 16: 94,370,194 probably null Het
Rp1 A G 1: 4,348,462 L809P probably benign Het
Scn3a T A 2: 65,494,781 probably benign Het
Sdf2 A T 11: 78,246,080 M29L probably benign Het
Serpina3b T G 12: 104,134,091 L311V possibly damaging Het
Snx31 A T 15: 36,523,488 Y349* probably null Het
Spidr A C 16: 16,114,869 C182W probably damaging Het
St13 A T 15: 81,377,798 S146R probably damaging Het
St8sia4 A G 1: 95,653,582 V145A probably damaging Het
Stradb T C 1: 58,980,016 probably null Het
Tcp11l2 T A 10: 84,594,797 probably benign Het
Tfdp2 C T 9: 96,317,574 P74S unknown Het
Tmprss15 C T 16: 79,057,659 R287H probably benign Het
Trav10d T C 14: 52,811,322 Y57H probably damaging Het
Vmn2r104 A G 17: 20,029,471 I846T probably benign Het
Ywhah T A 5: 33,026,948 M165K possibly damaging Het
Zfp324 C A 7: 12,969,366 P72T probably benign Het
Other mutations in Pcdhb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Pcdhb5 APN 18 37322109 missense probably damaging 1.00
IGL00895:Pcdhb5 APN 18 37320983 missense probably benign 0.42
IGL00896:Pcdhb5 APN 18 37322785 splice site probably null
IGL01385:Pcdhb5 APN 18 37322214 missense probably benign 0.00
IGL01619:Pcdhb5 APN 18 37322939 missense probably damaging 1.00
IGL01712:Pcdhb5 APN 18 37321253 missense probably damaging 1.00
IGL01716:Pcdhb5 APN 18 37321022 missense probably benign
IGL01719:Pcdhb5 APN 18 37321022 missense probably benign
IGL01720:Pcdhb5 APN 18 37321022 missense probably benign
IGL01723:Pcdhb5 APN 18 37321022 missense probably benign
IGL01724:Pcdhb5 APN 18 37321022 missense probably benign
IGL01839:Pcdhb5 APN 18 37321449 missense probably damaging 0.98
IGL01884:Pcdhb5 APN 18 37321334 missense probably benign 0.00
IGL01962:Pcdhb5 APN 18 37321040 missense probably damaging 1.00
IGL02088:Pcdhb5 APN 18 37321959 missense probably benign 0.11
IGL02299:Pcdhb5 APN 18 37320890 missense probably benign
IGL02444:Pcdhb5 APN 18 37321050 missense probably benign 0.01
IGL03372:Pcdhb5 APN 18 37320660 missense probably benign 0.22
R0034:Pcdhb5 UTSW 18 37322084 missense probably damaging 1.00
R0047:Pcdhb5 UTSW 18 37321268 missense possibly damaging 0.87
R0179:Pcdhb5 UTSW 18 37322559 missense probably damaging 1.00
R0466:Pcdhb5 UTSW 18 37322543 missense probably damaging 1.00
R0471:Pcdhb5 UTSW 18 37321306 nonsense probably null
R0565:Pcdhb5 UTSW 18 37320767 missense possibly damaging 0.91
R0646:Pcdhb5 UTSW 18 37321622 missense probably benign
R1014:Pcdhb5 UTSW 18 37322250 missense probably damaging 1.00
R1617:Pcdhb5 UTSW 18 37321402 nonsense probably null
R1676:Pcdhb5 UTSW 18 37320752 missense probably benign 0.01
R1774:Pcdhb5 UTSW 18 37322672 missense probably damaging 0.99
R1826:Pcdhb5 UTSW 18 37321469 nonsense probably null
R1854:Pcdhb5 UTSW 18 37322340 missense possibly damaging 0.94
R2355:Pcdhb5 UTSW 18 37322116 missense probably benign
R4290:Pcdhb5 UTSW 18 37322681 missense possibly damaging 0.90
R4292:Pcdhb5 UTSW 18 37322681 missense possibly damaging 0.90
R4293:Pcdhb5 UTSW 18 37322681 missense possibly damaging 0.90
R4294:Pcdhb5 UTSW 18 37322681 missense possibly damaging 0.90
R4295:Pcdhb5 UTSW 18 37322681 missense possibly damaging 0.90
R4391:Pcdhb5 UTSW 18 37322736 missense possibly damaging 0.88
R4411:Pcdhb5 UTSW 18 37321997 missense possibly damaging 0.80
R4480:Pcdhb5 UTSW 18 37320752 missense probably benign 0.43
R4852:Pcdhb5 UTSW 18 37322471 missense probably benign 0.04
R5121:Pcdhb5 UTSW 18 37321117 missense probably benign 0.11
R5133:Pcdhb5 UTSW 18 37320890 missense probably benign
R5630:Pcdhb5 UTSW 18 37321155 missense possibly damaging 0.88
R5833:Pcdhb5 UTSW 18 37321102 missense probably damaging 0.99
R5896:Pcdhb5 UTSW 18 37322679 nonsense probably null
R5942:Pcdhb5 UTSW 18 37320785 nonsense probably null
R5945:Pcdhb5 UTSW 18 37321470 missense probably benign 0.08
R6045:Pcdhb5 UTSW 18 37321575 missense probably damaging 1.00
R6054:Pcdhb5 UTSW 18 37321080 missense probably damaging 0.98
R6147:Pcdhb5 UTSW 18 37320726 missense probably damaging 1.00
R6152:Pcdhb5 UTSW 18 37322833 nonsense probably null
R6193:Pcdhb5 UTSW 18 37322027 missense probably damaging 1.00
R6397:Pcdhb5 UTSW 18 37321505 missense probably benign 0.08
R6505:Pcdhb5 UTSW 18 37320880 missense probably benign 0.00
R6608:Pcdhb5 UTSW 18 37321823 missense probably damaging 0.98
R6737:Pcdhb5 UTSW 18 37322670 missense probably damaging 1.00
R7146:Pcdhb5 UTSW 18 37321356 missense probably damaging 1.00
R7162:Pcdhb5 UTSW 18 37321686 missense probably benign 0.16
R7584:Pcdhb5 UTSW 18 37322372 missense possibly damaging 0.90
R8214:Pcdhb5 UTSW 18 37321583 missense probably benign 0.37
R8327:Pcdhb5 UTSW 18 37320900 missense probably benign 0.00
R8676:Pcdhb5 UTSW 18 37321076 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGAACGACAATGCCCCAGAG -3'
(R):5'- TGATGGTGCCAATGTGCAG -3'

Sequencing Primer
(F):5'- AGAGCTGACCATATCTTCACTG -3'
(R):5'- TGTTCTCGCGGACAAACATG -3'
Posted On2017-03-31