Incidental Mutation 'R7162:Pcdhb5'
ID557690
Institutional Source Beutler Lab
Gene Symbol Pcdhb5
Ensembl Gene ENSMUSG00000063687
Gene Nameprotocadherin beta 5
SynonymsPcdhb4A, PcdhbE
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R7162 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37320381-37323915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37321686 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 373 (D373G)
Ref Sequence ENSEMBL: ENSMUSP00000077389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078271] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000078271
AA Change: D373G

PolyPhen 2 Score 0.156 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000077389
Gene: ENSMUSG00000063687
AA Change: D373G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 46 130 1.55e0 SMART
CA 154 239 2.42e-18 SMART
CA 263 344 1.27e-26 SMART
CA 367 448 1.14e-23 SMART
CA 472 558 2.38e-26 SMART
CA 588 669 7.06e-11 SMART
Pfam:Cadherin_C_2 686 769 3.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (85/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akp3 C T 1: 87,127,749 T506I unknown Het
Ank1 T C 8: 23,132,354 W1640R possibly damaging Het
Atp2a2 A G 5: 122,489,324 M126T probably benign Het
Bptf A T 11: 107,043,631 probably null Het
Brat1 T C 5: 140,710,249 V125A probably benign Het
Cables1 T C 18: 11,926,366 probably null Het
Cabp5 A T 7: 13,401,335 M67L probably damaging Het
Cacna1b A C 2: 24,700,022 I558S probably benign Het
Ccdc166 A G 15: 75,981,195 S308P probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cfhr2 A G 1: 139,813,526 V237A probably benign Het
Clybl C A 14: 122,371,320 S108* probably null Het
Cubn A G 2: 13,342,498 Y2070H probably damaging Het
Cyp8b1 A G 9: 121,915,711 F185S probably damaging Het
Dennd2c T A 3: 103,156,107 V620D probably damaging Het
Dis3l2 T C 1: 87,044,030 F597L possibly damaging Het
Eif3f G A 7: 108,940,731 R282H probably benign Het
Ell C A 8: 70,578,909 R86S possibly damaging Het
Eppk1 A G 15: 76,106,609 V2024A possibly damaging Het
Exoc6 T C 19: 37,577,118 I214T probably damaging Het
Faim2 A G 15: 99,521,167 probably null Het
Gli1 A G 10: 127,332,437 S516P probably benign Het
Gm18596 A T 10: 77,742,200 S147T unknown Het
Gm19965 A G 1: 116,822,365 Y592C unknown Het
Gng12 T C 6: 67,017,301 S36P unknown Het
Gramd3 G A 18: 56,485,457 probably null Het
Hmcn1 T A 1: 150,748,993 T1054S probably benign Het
Ifngr1 A G 10: 19,609,353 T367A probably benign Het
Il21r G T 7: 125,632,311 V304L probably benign Het
Ino80d G A 1: 63,065,735 T394M probably damaging Het
Itfg2 C T 6: 128,410,583 V380M probably damaging Het
Kcna5 C T 6: 126,533,843 V441I possibly damaging Het
Kcp T A 6: 29,497,200 probably null Het
Kdf1 C T 4: 133,529,918 T375I unknown Het
Klk1b1 A T 7: 43,969,247 D16V probably damaging Het
Krtap5-4 A C 7: 142,303,598 T2P unknown Het
Lamtor1 A G 7: 101,906,036 D13G probably benign Het
Lrp10 T C 14: 54,465,706 V72A possibly damaging Het
Lrrc1 C A 9: 77,432,190 A503S probably benign Het
Mylk A T 16: 34,922,529 D1137V probably damaging Het
Myo5b C G 18: 74,695,427 L717V probably benign Het
Myoz3 T A 18: 60,576,413 R225S probably damaging Het
Myrf A G 19: 10,218,646 F335L possibly damaging Het
Nfib A C 4: 82,350,440 S292A probably damaging Het
Notch3 G T 17: 32,146,449 H1096Q probably damaging Het
Nt5c1a A G 4: 123,214,105 R194G probably benign Het
Olfr76 A G 19: 12,120,137 F192L possibly damaging Het
Olfr958 A G 9: 39,550,229 I214T probably damaging Het
Parp4 A G 14: 56,648,876 E1804G unknown Het
Pcdhac2 A T 18: 37,145,787 I607L probably benign Het
Pcf11 A T 7: 92,664,013 V154E probably damaging Het
Pdia3 T G 2: 121,429,521 D180E probably benign Het
Piezo2 C A 18: 63,124,709 V313F possibly damaging Het
Pik3ap1 C A 19: 41,321,526 A452S probably benign Het
Plb1 A G 5: 32,349,663 K1194R probably benign Het
Pld3 A C 7: 27,532,474 W431G probably damaging Het
Plekha3 T C 2: 76,692,766 probably null Het
Ppm1f G T 16: 16,914,193 R169L probably damaging Het
Ppp2r3d A G 9: 124,439,673 V60A Het
Prop1 T A 11: 50,952,054 D102V probably damaging Het
Rbm27 G A 18: 42,314,027 G446R unknown Het
Rc3h2 C A 2: 37,409,605 V138L possibly damaging Het
Rorc G A 3: 94,377,608 probably null Het
Sardh A G 2: 27,197,690 V723A possibly damaging Het
Sart3 A G 5: 113,762,835 Y181H probably damaging Het
Sbpl A T 17: 23,953,465 M160K possibly damaging Het
Sh3gl3 A G 7: 82,284,142 S238G probably benign Het
Slc22a30 A G 19: 8,336,717 probably null Het
Slc3a1 A T 17: 85,064,014 R665* probably null Het
Stk32a C A 18: 43,297,584 Y186* probably null Het
Stxbp6 T C 12: 44,902,880 N89D probably benign Het
Svep1 A G 4: 58,070,262 F2508S possibly damaging Het
Tas1r1 A G 4: 152,032,238 V313A possibly damaging Het
Tmem81 T C 1: 132,507,617 Y54H probably damaging Het
Tmtc1 T C 6: 148,271,487 N582S probably damaging Het
Top2b T C 14: 16,416,653 S1138P probably benign Het
Trim24 T A 6: 37,965,521 N989K possibly damaging Het
Trim72 T A 7: 128,007,649 M145K probably benign Het
Ttll9 T A 2: 152,989,603 S154T probably damaging Het
Tusc3 T C 8: 39,126,587 V286A probably benign Het
Vat1l C A 8: 114,236,778 H185N probably damaging Het
Vmn1r209 A T 13: 22,805,958 D187E probably damaging Het
Vmn2r87 T C 10: 130,477,547 N450S probably benign Het
Wdr7 T A 18: 63,724,139 D95E possibly damaging Het
Zfp937 C T 2: 150,239,519 H490Y probably benign Het
Zfp974 A T 7: 27,911,519 H260Q possibly damaging Het
Other mutations in Pcdhb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Pcdhb5 APN 18 37322109 missense probably damaging 1.00
IGL00895:Pcdhb5 APN 18 37320983 missense probably benign 0.42
IGL00896:Pcdhb5 APN 18 37322785 splice site probably null
IGL01385:Pcdhb5 APN 18 37322214 missense probably benign 0.00
IGL01619:Pcdhb5 APN 18 37322939 missense probably damaging 1.00
IGL01712:Pcdhb5 APN 18 37321253 missense probably damaging 1.00
IGL01716:Pcdhb5 APN 18 37321022 missense probably benign
IGL01719:Pcdhb5 APN 18 37321022 missense probably benign
IGL01720:Pcdhb5 APN 18 37321022 missense probably benign
IGL01723:Pcdhb5 APN 18 37321022 missense probably benign
IGL01724:Pcdhb5 APN 18 37321022 missense probably benign
IGL01839:Pcdhb5 APN 18 37321449 missense probably damaging 0.98
IGL01884:Pcdhb5 APN 18 37321334 missense probably benign 0.00
IGL01962:Pcdhb5 APN 18 37321040 missense probably damaging 1.00
IGL02088:Pcdhb5 APN 18 37321959 missense probably benign 0.11
IGL02299:Pcdhb5 APN 18 37320890 missense probably benign
IGL02444:Pcdhb5 APN 18 37321050 missense probably benign 0.01
IGL03372:Pcdhb5 APN 18 37320660 missense probably benign 0.22
R0034:Pcdhb5 UTSW 18 37322084 missense probably damaging 1.00
R0047:Pcdhb5 UTSW 18 37321268 missense possibly damaging 0.87
R0179:Pcdhb5 UTSW 18 37322559 missense probably damaging 1.00
R0466:Pcdhb5 UTSW 18 37322543 missense probably damaging 1.00
R0471:Pcdhb5 UTSW 18 37321306 nonsense probably null
R0565:Pcdhb5 UTSW 18 37320767 missense possibly damaging 0.91
R0646:Pcdhb5 UTSW 18 37321622 missense probably benign
R1014:Pcdhb5 UTSW 18 37322250 missense probably damaging 1.00
R1617:Pcdhb5 UTSW 18 37321402 nonsense probably null
R1676:Pcdhb5 UTSW 18 37320752 missense probably benign 0.01
R1774:Pcdhb5 UTSW 18 37322672 missense probably damaging 0.99
R1826:Pcdhb5 UTSW 18 37321469 nonsense probably null
R1854:Pcdhb5 UTSW 18 37322340 missense possibly damaging 0.94
R2355:Pcdhb5 UTSW 18 37322116 missense probably benign
R4290:Pcdhb5 UTSW 18 37322681 missense possibly damaging 0.90
R4292:Pcdhb5 UTSW 18 37322681 missense possibly damaging 0.90
R4293:Pcdhb5 UTSW 18 37322681 missense possibly damaging 0.90
R4294:Pcdhb5 UTSW 18 37322681 missense possibly damaging 0.90
R4295:Pcdhb5 UTSW 18 37322681 missense possibly damaging 0.90
R4391:Pcdhb5 UTSW 18 37322736 missense possibly damaging 0.88
R4411:Pcdhb5 UTSW 18 37321997 missense possibly damaging 0.80
R4480:Pcdhb5 UTSW 18 37320752 missense probably benign 0.43
R4852:Pcdhb5 UTSW 18 37322471 missense probably benign 0.04
R5121:Pcdhb5 UTSW 18 37321117 missense probably benign 0.11
R5133:Pcdhb5 UTSW 18 37320890 missense probably benign
R5630:Pcdhb5 UTSW 18 37321155 missense possibly damaging 0.88
R5833:Pcdhb5 UTSW 18 37321102 missense probably damaging 0.99
R5896:Pcdhb5 UTSW 18 37322679 nonsense probably null
R5942:Pcdhb5 UTSW 18 37320785 nonsense probably null
R5945:Pcdhb5 UTSW 18 37321470 missense probably benign 0.08
R5970:Pcdhb5 UTSW 18 37321773 missense probably damaging 1.00
R6045:Pcdhb5 UTSW 18 37321575 missense probably damaging 1.00
R6054:Pcdhb5 UTSW 18 37321080 missense probably damaging 0.98
R6147:Pcdhb5 UTSW 18 37320726 missense probably damaging 1.00
R6152:Pcdhb5 UTSW 18 37322833 nonsense probably null
R6193:Pcdhb5 UTSW 18 37322027 missense probably damaging 1.00
R6397:Pcdhb5 UTSW 18 37321505 missense probably benign 0.08
R6505:Pcdhb5 UTSW 18 37320880 missense probably benign 0.00
R6608:Pcdhb5 UTSW 18 37321823 missense probably damaging 0.98
R6737:Pcdhb5 UTSW 18 37322670 missense probably damaging 1.00
R7146:Pcdhb5 UTSW 18 37321356 missense probably damaging 1.00
R7584:Pcdhb5 UTSW 18 37322372 missense possibly damaging 0.90
R8214:Pcdhb5 UTSW 18 37321583 missense probably benign 0.37
R8327:Pcdhb5 UTSW 18 37320900 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTACCATGTAGAAATTGAGGCCAC -3'
(R):5'- GTTGTCGTTAATGTCGGACACC -3'

Sequencing Primer
(F):5'- CACAGATGGAGGAGGCCTTTCTG -3'
(R):5'- AATGTCGGACACCTTCACTG -3'
Posted On2019-06-26