Incidental Mutation 'R1943:Fh1'
ID216342
Institutional Source Beutler Lab
Gene Symbol Fh1
Ensembl Gene ENSMUSG00000026526
Gene Namefumarate hydratase 1
Synonymsfumarase
MMRRC Submission 039961-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1943 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location175600374-175625635 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 175609778 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 252 (V252I)
Ref Sequence ENSEMBL: ENSMUSP00000027810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027810] [ENSMUST00000154956]
Predicted Effect probably benign
Transcript: ENSMUST00000027810
AA Change: V252I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027810
Gene: ENSMUSG00000026526
AA Change: V252I

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Pfam:Lyase_1 55 386 1.8e-124 PFAM
Pfam:FumaraseC_C 452 505 2.5e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133218
Predicted Effect probably benign
Transcript: ENSMUST00000154956
SMART Domains Protein: ENSMUSP00000135140
Gene: ENSMUSG00000026526

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176740
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzymatic component of the tricarboxylic acid (TCA) cycle, or Krebs cycle, and catalyzes the formation of L-malate from fumarate. It exists in both a cytosolic form and an N-terminal extended form, differing only in the translation start site used. The N-terminal extended form is targeted to the mitochondrion, where the removal of the extension generates the same form as in the cytoplasm. It is similar to some thermostable class II fumarases and functions as a homotetramer. Mutations in this gene can cause fumarase deficiency and lead to progressive encephalopathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a knock-out allele fail to develop past the egg-cylinder stage and die at E6.0. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,668,547 N1017S possibly damaging Het
Abca8a T C 11: 110,069,863 I610V probably benign Het
Acp5 C T 9: 22,129,604 V108M probably damaging Het
Adam23 T C 1: 63,477,757 probably null Het
Adam34 T A 8: 43,650,827 T594S possibly damaging Het
Adam34 A T 8: 43,651,815 N264K probably damaging Het
Arsa G A 15: 89,473,539 T407I probably damaging Het
Bicc1 A G 10: 71,159,523 S32P probably damaging Het
Cacna1i T A 15: 80,395,044 D1995E probably benign Het
Chst15 A T 7: 132,262,850 probably null Het
Cntnap4 T A 8: 112,815,496 F754I probably benign Het
Cpz C T 5: 35,512,428 E302K probably damaging Het
Daw1 A T 1: 83,209,266 I371F possibly damaging Het
Dennd1b C A 1: 139,168,952 probably benign Het
Dhtkd1 T G 2: 5,932,482 Q73P probably benign Het
Dmgdh T C 13: 93,711,370 I525T probably benign Het
Dst C A 1: 34,228,369 T4964K possibly damaging Het
Ercc3 A G 18: 32,246,610 Y290C probably damaging Het
Gm13199 C T 2: 5,862,706 probably benign Het
Il1rn T C 2: 24,348,599 S82P possibly damaging Het
Lama4 T C 10: 39,097,138 V1567A possibly damaging Het
Lamtor4 A G 5: 138,255,792 probably null Het
Llgl1 A G 11: 60,706,016 N148D probably benign Het
Lmo7 G T 14: 101,902,302 G774V probably damaging Het
Luzp2 A T 7: 55,264,302 K293M possibly damaging Het
Mknk1 T C 4: 115,863,026 V83A probably damaging Het
Mug2 T C 6: 122,079,639 V1181A probably benign Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Olfr169 A T 16: 19,566,437 W149R probably benign Het
Olfr51 A G 11: 51,007,675 I234M probably benign Het
Osbpl3 A G 6: 50,320,074 I548T probably benign Het
Parp14 A G 16: 35,836,129 Y1676H probably damaging Het
Phtf1 A T 3: 103,993,882 K416* probably null Het
Pmp2 T C 3: 10,182,510 T40A probably benign Het
Ptpra T C 2: 130,544,104 M541T probably damaging Het
Rapgef6 A G 11: 54,657,263 I753V possibly damaging Het
Rdh14 T C 12: 10,391,162 V108A probably benign Het
Rnf38 A T 4: 44,138,748 H248Q probably damaging Het
Rsph6a A C 7: 19,074,076 Y388S probably damaging Het
Ryr2 T C 13: 11,731,723 D1981G probably benign Het
Sf3a3 A G 4: 124,715,901 K97E possibly damaging Het
Shisa9 A G 16: 12,267,756 T394A probably benign Het
Slc43a2 T A 11: 75,545,741 probably null Het
Slc45a1 A G 4: 150,644,277 F23S probably benign Het
Slc7a10 T A 7: 35,200,298 V435E probably benign Het
Snx15 A G 19: 6,128,066 Y28H probably damaging Het
Spef2 T G 15: 9,663,194 K834Q possibly damaging Het
Tdpoz2 G T 3: 93,651,923 Y247* probably null Het
Tedc2 G A 17: 24,217,949 R271W possibly damaging Het
Tfr2 C A 5: 137,578,921 H378Q probably benign Het
Tigit T A 16: 43,649,218 H170L probably benign Het
Tmem2 G A 19: 21,848,040 probably null Het
Tmem62 A T 2: 120,986,626 Q91L probably benign Het
Tmtc1 G T 6: 148,425,918 C32* probably null Het
Txndc12 G A 4: 108,856,210 V90I probably benign Het
Vmn2r93 C A 17: 18,325,801 T645K probably benign Het
Vmn2r96 C T 17: 18,586,402 T345I probably benign Het
Vps13d A T 4: 145,155,857 D1055E probably benign Het
Xirp2 A G 2: 67,512,615 I1733M probably benign Het
Zfp512b T C 2: 181,588,415 H516R probably damaging Het
Zfp606 T C 7: 12,493,688 S521P probably damaging Het
Zfp715 A T 7: 43,299,630 V302E possibly damaging Het
Other mutations in Fh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01723:Fh1 APN 1 175601542 missense probably damaging 1.00
IGL02637:Fh1 APN 1 175609766 missense probably benign 0.00
IGL02954:Fh1 APN 1 175609735 missense probably damaging 1.00
IGL03056:Fh1 APN 1 175606162 missense probably damaging 1.00
IGL03309:Fh1 APN 1 175604043 missense probably benign 0.01
R0729:Fh1 UTSW 1 175614817 missense probably damaging 1.00
R1240:Fh1 UTSW 1 175604015 missense probably damaging 1.00
R1327:Fh1 UTSW 1 175609744 missense probably benign 0.32
R1576:Fh1 UTSW 1 175607819 missense probably null 1.00
R1779:Fh1 UTSW 1 175601424 makesense probably null
R1823:Fh1 UTSW 1 175616548 missense probably damaging 1.00
R1851:Fh1 UTSW 1 175607886 missense probably damaging 1.00
R2163:Fh1 UTSW 1 175614840 missense possibly damaging 0.80
R3766:Fh1 UTSW 1 175614750 missense probably damaging 1.00
R4193:Fh1 UTSW 1 175614841 missense possibly damaging 0.51
R4672:Fh1 UTSW 1 175604051 missense probably benign 0.07
R4812:Fh1 UTSW 1 175601459 missense probably damaging 0.99
R4849:Fh1 UTSW 1 175620506 missense probably benign 0.00
R4905:Fh1 UTSW 1 175619073 missense probably damaging 1.00
R4978:Fh1 UTSW 1 175603967 missense probably damaging 1.00
R6645:Fh1 UTSW 1 175614876 missense possibly damaging 0.94
R6681:Fh1 UTSW 1 175619124 missense probably null 0.71
R7075:Fh1 UTSW 1 175607855 missense probably benign 0.00
R7646:Fh1 UTSW 1 175614913 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGAGTAGCAATGCATGTGGTC -3'
(R):5'- AGCAATAGTTCAGTGTAGTGGAGC -3'

Sequencing Primer
(F):5'- ATGCATGTGGTCCCCAAC -3'
(R):5'- GGGACGTTTGGTTATAAACTAAGC -3'
Posted On2014-08-01