Incidental Mutation 'R1943:Tmem2'
ID216410
Institutional Source Beutler Lab
Gene Symbol Tmem2
Ensembl Gene ENSMUSG00000024754
Gene Nametransmembrane protein 2
Synonyms
MMRRC Submission 039961-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.821) question?
Stock #R1943 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location21778342-21858327 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 21848040 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000093908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025663] [ENSMUST00000096194]
Predicted Effect probably null
Transcript: ENSMUST00000025663
SMART Domains Protein: ENSMUSP00000025663
Gene: ENSMUSG00000024754

DomainStartEndE-ValueType
transmembrane domain 83 105 N/A INTRINSIC
G8 121 245 1.89e-44 SMART
Pfam:ILEI 265 360 2.1e-24 PFAM
Blast:PbH1 587 609 1e-6 BLAST
low complexity region 621 633 N/A INTRINSIC
PbH1 669 691 3.62e3 SMART
PbH1 711 733 1.84e3 SMART
PbH1 791 812 1.33e3 SMART
Pfam:ILEI 1243 1333 9e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000096194
SMART Domains Protein: ENSMUSP00000093908
Gene: ENSMUSG00000024754

DomainStartEndE-ValueType
transmembrane domain 83 105 N/A INTRINSIC
G8 121 245 1.89e-44 SMART
Blast:PbH1 587 609 1e-6 BLAST
low complexity region 621 633 N/A INTRINSIC
PbH1 669 691 3.62e3 SMART
PbH1 711 733 1.84e3 SMART
PbH1 791 812 1.33e3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,668,547 N1017S possibly damaging Het
Abca8a T C 11: 110,069,863 I610V probably benign Het
Acp5 C T 9: 22,129,604 V108M probably damaging Het
Adam23 T C 1: 63,477,757 probably null Het
Adam34 T A 8: 43,650,827 T594S possibly damaging Het
Adam34 A T 8: 43,651,815 N264K probably damaging Het
Arsa G A 15: 89,473,539 T407I probably damaging Het
Bicc1 A G 10: 71,159,523 S32P probably damaging Het
Cacna1i T A 15: 80,395,044 D1995E probably benign Het
Chst15 A T 7: 132,262,850 probably null Het
Cntnap4 T A 8: 112,815,496 F754I probably benign Het
Cpz C T 5: 35,512,428 E302K probably damaging Het
Daw1 A T 1: 83,209,266 I371F possibly damaging Het
Dennd1b C A 1: 139,168,952 probably benign Het
Dhtkd1 T G 2: 5,932,482 Q73P probably benign Het
Dmgdh T C 13: 93,711,370 I525T probably benign Het
Dst C A 1: 34,228,369 T4964K possibly damaging Het
Ercc3 A G 18: 32,246,610 Y290C probably damaging Het
Fh1 C T 1: 175,609,778 V252I probably benign Het
Gm13199 C T 2: 5,862,706 probably benign Het
Il1rn T C 2: 24,348,599 S82P possibly damaging Het
Lama4 T C 10: 39,097,138 V1567A possibly damaging Het
Lamtor4 A G 5: 138,255,792 probably null Het
Llgl1 A G 11: 60,706,016 N148D probably benign Het
Lmo7 G T 14: 101,902,302 G774V probably damaging Het
Luzp2 A T 7: 55,264,302 K293M possibly damaging Het
Mknk1 T C 4: 115,863,026 V83A probably damaging Het
Mug2 T C 6: 122,079,639 V1181A probably benign Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Olfr169 A T 16: 19,566,437 W149R probably benign Het
Olfr51 A G 11: 51,007,675 I234M probably benign Het
Osbpl3 A G 6: 50,320,074 I548T probably benign Het
Parp14 A G 16: 35,836,129 Y1676H probably damaging Het
Phtf1 A T 3: 103,993,882 K416* probably null Het
Pmp2 T C 3: 10,182,510 T40A probably benign Het
Ptpra T C 2: 130,544,104 M541T probably damaging Het
Rapgef6 A G 11: 54,657,263 I753V possibly damaging Het
Rdh14 T C 12: 10,391,162 V108A probably benign Het
Rnf38 A T 4: 44,138,748 H248Q probably damaging Het
Rsph6a A C 7: 19,074,076 Y388S probably damaging Het
Ryr2 T C 13: 11,731,723 D1981G probably benign Het
Sf3a3 A G 4: 124,715,901 K97E possibly damaging Het
Shisa9 A G 16: 12,267,756 T394A probably benign Het
Slc43a2 T A 11: 75,545,741 probably null Het
Slc45a1 A G 4: 150,644,277 F23S probably benign Het
Slc7a10 T A 7: 35,200,298 V435E probably benign Het
Snx15 A G 19: 6,128,066 Y28H probably damaging Het
Spef2 T G 15: 9,663,194 K834Q possibly damaging Het
Tdpoz2 G T 3: 93,651,923 Y247* probably null Het
Tedc2 G A 17: 24,217,949 R271W possibly damaging Het
Tfr2 C A 5: 137,578,921 H378Q probably benign Het
Tigit T A 16: 43,649,218 H170L probably benign Het
Tmem62 A T 2: 120,986,626 Q91L probably benign Het
Tmtc1 G T 6: 148,425,918 C32* probably null Het
Txndc12 G A 4: 108,856,210 V90I probably benign Het
Vmn2r93 C A 17: 18,325,801 T645K probably benign Het
Vmn2r96 C T 17: 18,586,402 T345I probably benign Het
Vps13d A T 4: 145,155,857 D1055E probably benign Het
Xirp2 A G 2: 67,512,615 I1733M probably benign Het
Zfp512b T C 2: 181,588,415 H516R probably damaging Het
Zfp606 T C 7: 12,493,688 S521P probably damaging Het
Zfp715 A T 7: 43,299,630 V302E possibly damaging Het
Other mutations in Tmem2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Tmem2 APN 19 21844757 missense possibly damaging 0.77
IGL01528:Tmem2 APN 19 21835545 missense possibly damaging 0.95
IGL01642:Tmem2 APN 19 21823901 missense probably damaging 1.00
IGL01693:Tmem2 APN 19 21801887 missense probably benign 0.00
IGL02437:Tmem2 APN 19 21811978 critical splice donor site probably null
IGL02869:Tmem2 APN 19 21811877 missense probably damaging 0.99
IGL02880:Tmem2 APN 19 21823843 missense possibly damaging 0.68
IGL02904:Tmem2 APN 19 21823843 missense possibly damaging 0.68
IGL02941:Tmem2 APN 19 21823843 missense possibly damaging 0.68
IGL02950:Tmem2 APN 19 21842200 missense probably benign 0.07
IGL03066:Tmem2 APN 19 21823843 missense possibly damaging 0.68
IGL03120:Tmem2 APN 19 21823843 missense possibly damaging 0.68
R0005:Tmem2 UTSW 19 21812220 missense probably damaging 0.98
R0496:Tmem2 UTSW 19 21797345 missense possibly damaging 0.89
R0557:Tmem2 UTSW 19 21811903 missense probably benign 0.05
R0620:Tmem2 UTSW 19 21817971 missense probably benign
R1271:Tmem2 UTSW 19 21823904 missense possibly damaging 0.92
R1435:Tmem2 UTSW 19 21844706 missense probably benign
R1543:Tmem2 UTSW 19 21812573 missense probably benign 0.03
R1558:Tmem2 UTSW 19 21797982 nonsense probably null
R1658:Tmem2 UTSW 19 21801879 missense probably damaging 1.00
R1744:Tmem2 UTSW 19 21832137 nonsense probably null
R1859:Tmem2 UTSW 19 21847977 missense possibly damaging 0.56
R2001:Tmem2 UTSW 19 21801987 missense probably benign 0.43
R2021:Tmem2 UTSW 19 21844750 missense possibly damaging 0.91
R2177:Tmem2 UTSW 19 21811785 missense possibly damaging 0.80
R2183:Tmem2 UTSW 19 21823793 missense possibly damaging 0.81
R2921:Tmem2 UTSW 19 21817939 missense possibly damaging 0.80
R2922:Tmem2 UTSW 19 21817939 missense possibly damaging 0.80
R2923:Tmem2 UTSW 19 21817939 missense possibly damaging 0.80
R3727:Tmem2 UTSW 19 21844711 missense probably benign
R3730:Tmem2 UTSW 19 21826117 missense probably damaging 0.97
R3790:Tmem2 UTSW 19 21807452 missense probably damaging 1.00
R3831:Tmem2 UTSW 19 21847951 missense probably damaging 0.97
R3858:Tmem2 UTSW 19 21852234 missense probably benign 0.01
R3859:Tmem2 UTSW 19 21852234 missense probably benign 0.01
R3899:Tmem2 UTSW 19 21852234 missense probably benign 0.01
R4096:Tmem2 UTSW 19 21792652 start codon destroyed probably null 0.99
R4206:Tmem2 UTSW 19 21842115 missense probably damaging 1.00
R4480:Tmem2 UTSW 19 21815489 missense probably benign 0.03
R4667:Tmem2 UTSW 19 21797351 missense probably benign 0.00
R4667:Tmem2 UTSW 19 21844781 missense probably benign
R4888:Tmem2 UTSW 19 21856164 missense probably benign 0.00
R4914:Tmem2 UTSW 19 21809289 missense probably benign 0.00
R5030:Tmem2 UTSW 19 21842105 missense probably benign
R5329:Tmem2 UTSW 19 21798329 missense probably benign 0.30
R5977:Tmem2 UTSW 19 21826083 missense probably benign 0.01
R6013:Tmem2 UTSW 19 21832039 missense possibly damaging 0.89
R6049:Tmem2 UTSW 19 21826126 missense probably benign
R6199:Tmem2 UTSW 19 21844822 missense probably benign 0.05
R6215:Tmem2 UTSW 19 21812387 missense probably benign 0.02
R6273:Tmem2 UTSW 19 21802005 missense probably damaging 1.00
R6429:Tmem2 UTSW 19 21801908 missense probably benign 0.14
R6547:Tmem2 UTSW 19 21844831 missense probably benign 0.01
R6630:Tmem2 UTSW 19 21852229 missense probably damaging 0.99
R6870:Tmem2 UTSW 19 21832123 missense possibly damaging 0.91
R7276:Tmem2 UTSW 19 21835460 missense probably benign 0.14
R7336:Tmem2 UTSW 19 21826145 nonsense probably null
R7363:Tmem2 UTSW 19 21856211 missense probably benign
R7678:Tmem2 UTSW 19 21798116 missense probably damaging 1.00
R7727:Tmem2 UTSW 19 21829957 missense probably benign 0.00
R7820:Tmem2 UTSW 19 21807461 missense probably damaging 0.98
R7837:Tmem2 UTSW 19 21798021 missense probably benign 0.40
R7859:Tmem2 UTSW 19 21832175 missense possibly damaging 0.95
R7954:Tmem2 UTSW 19 21792900 missense probably damaging 1.00
R7964:Tmem2 UTSW 19 21798430 critical splice donor site probably null
R8058:Tmem2 UTSW 19 21852331 missense probably benign 0.12
R8251:Tmem2 UTSW 19 21807401 missense possibly damaging 0.82
Z1177:Tmem2 UTSW 19 21855729 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTTGGTATGTTTTCAGTGACC -3'
(R):5'- TCTGTACCTGGCCAAAAGGC -3'

Sequencing Primer
(F):5'- GACCTGTGGGCATGGATAC -3'
(R):5'- CAACACTATGGTTCGATATCTGTGCG -3'
Posted On2014-08-01