Mutagenetix > Incidental Mutations

Incidental Mutation 'R1954:Cytip'

217537

Institutional Source

Beutler Lab

Gene Symbol

Cytip

Ensembl Gene

ENSMUSG00000026832

Gene Name

cytohesin 1 interacting protein

Synonyms

A130053M09Rik, Pscdbp, Cybr, Cbp

MMRRC Submission

039968-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1954 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

58129137-58195532 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 58148253 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 99 (N99D)

Ref Sequence

ENSEMBL: ENSMUSP00000028175 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028175]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000028175
AA Change: N99D

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000028175
Gene: ENSMUSG00000026832
AA Change: N99D

Domain	Start	End	E-Value	Type
PDZ	86	166	6.88e-13	SMART
low complexity region	177	188	N/A	INTRINSIC
low complexity region	240	253	N/A	INTRINSIC
low complexity region	295	306	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131443

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144117

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146545

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148764

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151785

Meta Mutation Damage Score

0.1042

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

97% (101/104)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains 2 leucine zipper domains and a putative C-terminal nuclear targeting signal, but does not have any hydrophobic regions. This protein is expressed weakly in resting NK and T cells. The encoded protein modulates the activation of ARF genes by CYTH1. This protein interacts with CYTH1 and SNX27 proteins and may act to sequester CYTH1 protein in the cytoplasm.[provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a null allele display impaired trafficking and/or cell adhesion of immune system cells. Mice homozygous for a reporter allele show normal immune cell development and function; however, mutant hematopoietic stems cells have impaired repopulating activity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007G11Rik	A	T	5: 98,566,753		probably benign	Het
Adamts15	T	A	9: 30,910,708	M478L	probably benign	Het
Akap8l	T	A	17: 32,336,736	Y123F	possibly damaging	Het
Anapc4	T	G	5: 52,846,625		probably benign	Het
Arap3	A	G	18: 37,982,002	V987A	probably damaging	Het
Atp2b4	T	A	1: 133,739,992	T105S	probably damaging	Het
Atp6v0d1	A	G	8: 105,565,893	L7P	probably damaging	Het
Atp6v1b2	T	C	8: 69,105,903	V341A	possibly damaging	Het
Baz2b	C	A	2: 59,968,743	A346S	probably benign	Het
Brpf3	G	A	17: 28,806,559	S202N	probably benign	Het
Btnl4	T	C	17: 34,472,930	K233E	possibly damaging	Het
Capn7	A	G	14: 31,360,150	T438A	probably damaging	Het
Cars2	A	T	8: 11,550,286	Y68N	probably damaging	Het
Cbx2	G	T	11: 119,028,340	G244W	probably damaging	Het
Ccr4	A	T	9: 114,492,685	V104D	probably damaging	Het
Cdc5l	T	C	17: 45,426,516		probably null	Het
Cep170	A	T	1: 176,756,384	C810S	probably benign	Het
Clp1	T	C	2: 84,724,051	D258G	probably damaging	Het
Clstn3	T	C	6: 124,459,298	E164G	possibly damaging	Het
Col28a1	T	C	6: 7,998,516	E1131G	probably damaging	Het
Cps1	A	G	1: 67,195,196	D914G	possibly damaging	Het
Ctnnal1	C	T	4: 56,817,242		probably benign	Het
Cyp2c38	A	G	19: 39,404,687	L312P	probably damaging	Het
Dennd4a	A	T	9: 64,852,467	T285S	probably benign	Het
Dhx8	A	G	11: 101,753,279	S842G	probably damaging	Het
Disp1	A	T	1: 183,088,543	M771K	probably damaging	Het
Dnah17	A	G	11: 118,024,731	I4326T	probably damaging	Het
Efcab7	T	C	4: 99,900,690	F345L	probably damaging	Het
Erc1	G	T	6: 119,797,305	Q230K	probably damaging	Het
Ern1	A	T	11: 106,421,974		probably benign	Het
Espl1	T	C	15: 102,298,388	Y96H	probably damaging	Het
Fam135a	A	T	1: 24,029,602	L533I	probably damaging	Het
Fat2	G	A	11: 55,311,084	T388I	probably benign	Het
Galnt1	T	G	18: 24,271,774		probably benign	Het
Glmn	A	G	5: 107,572,377	F212S	probably damaging	Het
Gm3604	A	T	13: 62,369,211	N444K	probably damaging	Het
Gm5434	A	G	12: 36,090,596		probably benign	Het
Gm8989	A	C	7: 106,329,681	D336E	probably damaging	Het
H2-M10.3	T	C	17: 36,367,498	D145G	probably damaging	Het
Hic2	T	A	16: 17,258,993	L562Q	probably damaging	Het
Hip1r	G	T	5: 124,001,844	E1003D	probably damaging	Het
Hist1h1c	T	C	13: 23,739,402	V185A	unknown	Het
Hist1h1d	A	G	13: 23,555,516		probably benign	Het
Hsfy2	C	T	1: 56,637,183	C65Y	probably benign	Het
Inpp1	T	C	1: 52,794,629	T103A	probably damaging	Het
Ints5	T	C	19: 8,894,896	V73A	probably damaging	Het
Iqch	A	T	9: 63,548,016	D166E	probably benign	Het
Klhdc3	A	T	17: 46,677,975	N96K	probably damaging	Het
Klk1b8	C	T	7: 43,953,848		probably benign	Het
Klrb1	T	C	6: 128,723,073		probably null	Het
Krt71	C	A	15: 101,735,466	G446*	probably null	Het
Lars	G	A	18: 42,210,050	R1101C	probably damaging	Het
Lemd3	G	T	10: 120,978,940	S129R	probably damaging	Het
Lrp1b	A	G	2: 40,858,441	L3015P	probably damaging	Het
Mdga2	T	C	12: 66,486,708		probably benign	Het
Mlst8	A	T	17: 24,477,221	I178N	probably damaging	Het
Mon2	A	T	10: 123,038,483	I320N	probably damaging	Het
Morc2b	T	C	17: 33,137,490	Y436C	probably damaging	Het
Moxd1	T	A	10: 24,279,883	M295K	probably benign	Het
Mrps5	T	A	2: 127,596,897		probably null	Het
Mtor	C	A	4: 148,468,273	S744R	probably damaging	Het
Myo3a	T	A	2: 22,241,226	D61E	probably damaging	Het
Nars	C	T	18: 64,500,564	R545Q	probably damaging	Het
Ncoa6	A	G	2: 155,406,821	V1521A	possibly damaging	Het
Ndor1	T	C	2: 25,255,293	E20G	possibly damaging	Het
Nipsnap3b	T	C	4: 53,017,213		probably benign	Het
Notch3	G	T	17: 32,166,678	A39E	probably benign	Het
Olfr1336	G	T	7: 6,461,145	W212L	probably benign	Het
Olfr237-ps1	T	C	6: 43,153,977	I224T	possibly damaging	Het
Olfr345	A	G	2: 36,640,215	M59V	possibly damaging	Het
Otud3	T	C	4: 138,898,032	K237R	possibly damaging	Het
Papola	T	A	12: 105,828,273		probably null	Het
Parl	T	A	16: 20,302,327	M1L	possibly damaging	Het
Parp14	G	T	16: 35,858,301	N432K	probably benign	Het
Patz1	T	G	11: 3,291,088	S159A	probably damaging	Het
Prpf6	T	G	2: 181,632,077	M338R	probably benign	Het
Psd3	A	G	8: 67,697,075	L343P	probably damaging	Het
Ptpn23	A	T	9: 110,386,325	N1422K	probably damaging	Het
Rab19	A	T	6: 39,384,082	T55S	probably benign	Het
Sh3yl1	A	G	12: 30,922,333	K34E	possibly damaging	Het
Skint8	T	A	4: 111,950,081	F321L	possibly damaging	Het
Slc25a46	A	T	18: 31,600,241		probably null	Het
Slc26a3	T	C	12: 31,450,816	L184S	probably damaging	Het
Slc39a10	A	T	1: 46,835,174	S323T	possibly damaging	Het
Sorbs2	G	T	8: 45,745,738	R20L	probably benign	Het
Stk32a	A	T	18: 43,212,025	D13V	probably benign	Het
Tab2	T	C	10: 7,919,330	T463A	probably damaging	Het
Tenm2	T	A	11: 36,047,547	N1433I	possibly damaging	Het
Tmem200c	A	T	17: 68,840,961	I180F	probably damaging	Het
Tmem232	G	T	17: 65,484,487	H129N	probably benign	Het
Tmem242	T	C	17: 5,439,579	T47A	possibly damaging	Het
Ube2d1	A	T	10: 71,285,123	M1K	probably null	Het
Uckl1	T	C	2: 181,570,527	Q332R	probably benign	Het
Unc5b	T	C	10: 60,769,265		probably benign	Het
Vmn2r114	T	C	17: 23,311,112	Y107C	probably benign	Het
Vmn2r82	A	T	10: 79,396,056	S630C	probably damaging	Het
Wdr25	T	A	12: 108,898,541	V204E	probably damaging	Het
Xab2	T	A	8: 3,616,094	D227V	probably damaging	Het
Zfp286	A	G	11: 62,783,708	S104P	possibly damaging	Het
Zfp345	T	C	2: 150,474,821	D22G	probably damaging	Het

Other mutations in Cytip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01635:Cytip	APN	2	58148231	missense	probably damaging	1.00
IGL01670:Cytip	APN	2	58133773	missense	probably damaging	1.00
IGL02184:Cytip	APN	2	58133738	missense	probably damaging	1.00
IGL02271:Cytip	APN	2	58133860	nonsense	probably null
IGL02468:Cytip	APN	2	58134013	missense	probably benign	0.08
R0079:Cytip	UTSW	2	58159994	missense	probably benign	0.37
R0304:Cytip	UTSW	2	58148246	missense	possibly damaging	0.87
R0612:Cytip	UTSW	2	58134190	missense	possibly damaging	0.46
R1448:Cytip	UTSW	2	58145180	missense	probably damaging	1.00
R1822:Cytip	UTSW	2	58134146	missense	probably benign	0.00
R4401:Cytip	UTSW	2	58133935	missense	probably benign	0.01
R4578:Cytip	UTSW	2	58160012	missense	possibly damaging	0.95
R5101:Cytip	UTSW	2	58147899	missense	probably damaging	1.00
R7104:Cytip	UTSW	2	58159974	missense	probably benign	0.00
R7703:Cytip	UTSW	2	58147908	missense	probably damaging	1.00
R7966:Cytip	UTSW	2	58147932	missense	probably damaging	1.00
R8492:Cytip	UTSW	2	58137857	critical splice donor site	probably null
Z1176:Cytip	UTSW	2	58134037	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGATGTCACCTGTGGGATGC -3'
(R):5'- GGGATTGCAAAATTGGTAACTTCC -3'

Sequencing Primer
(F):5'- TTTATTAGCTACGTAAACAATCCCC -3'
(R):5'- CCATTCAGTGTATGTCGAGAAAAGC -3'

Posted On

2014-08-01