Incidental Mutation 'R1965:Phospho1'
ID218302
Institutional Source Beutler Lab
Gene Symbol Phospho1
Ensembl Gene ENSMUSG00000050860
Gene Namephosphatase, orphan 1
SynonymsD11Moh36
MMRRC Submission 039978-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R1965 (G1)
Quality Score213
Status Not validated
Chromosome11
Chromosomal Location95824499-95832140 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95830879 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 125 (N125S)
Ref Sequence ENSEMBL: ENSMUSP00000057858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054173] [ENSMUST00000059026] [ENSMUST00000133070] [ENSMUST00000150134]
Predicted Effect probably damaging
Transcript: ENSMUST00000054173
AA Change: N125S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057858
Gene: ENSMUSG00000050860
AA Change: N125S

DomainStartEndE-ValueType
Pfam:Put_Phosphatase 27 264 6.9e-103 PFAM
Pfam:HAD 29 211 1.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059026
SMART Domains Protein: ENSMUSP00000061893
Gene: ENSMUSG00000018381

DomainStartEndE-ValueType
low complexity region 4 11 N/A INTRINSIC
Pfam:Abi_HHR 96 168 4.3e-31 PFAM
low complexity region 206 225 N/A INTRINSIC
low complexity region 233 252 N/A INTRINSIC
low complexity region 259 303 N/A INTRINSIC
SH3 312 367 1.41e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131049
Predicted Effect probably benign
Transcript: ENSMUST00000133070
SMART Domains Protein: ENSMUSP00000122280
Gene: ENSMUSG00000075595

DomainStartEndE-ValueType
low complexity region 95 108 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
low complexity region 173 213 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
ZnF_C2H2 244 267 7.9e-4 SMART
ZnF_C2H2 271 291 6.15e1 SMART
ZnF_C2H2 298 321 1.76e-1 SMART
ZnF_C2H2 328 350 2.53e-2 SMART
ZnF_C2H2 356 378 6.78e-3 SMART
ZnF_C2H2 384 406 2.95e-3 SMART
ZnF_C2H2 412 434 1.95e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137645
SMART Domains Protein: ENSMUSP00000119990
Gene: ENSMUSG00000018381

DomainStartEndE-ValueType
Pfam:Abi_HHR 1 49 8.8e-14 PFAM
low complexity region 87 106 N/A INTRINSIC
low complexity region 114 133 N/A INTRINSIC
low complexity region 140 183 N/A INTRINSIC
SH3 192 244 2.89e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150134
Predicted Effect unknown
Transcript: ENSMUST00000176538
AA Change: N39S
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit fractures, bowed long bones, osteomalacia, and scoliosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik T A 5: 98,346,234 D32E probably damaging Het
1700042G07Rik G A 4: 116,174,179 C82Y probably damaging Het
Aco1 T G 4: 40,175,730 L157R probably damaging Het
Acot11 A T 4: 106,749,353 L513Q probably damaging Het
Amd1 A G 10: 40,294,759 I52T probably benign Het
Ap2b1 T C 11: 83,346,895 I557T probably benign Het
Arel1 T A 12: 84,940,399 probably null Het
Arg1 T A 10: 24,916,864 probably null Het
Atf1 A T 15: 100,254,171 M135L probably benign Het
Atf2 T C 2: 73,850,898 E77G possibly damaging Het
Axin1 G T 17: 26,184,225 A394S probably damaging Het
Axin1 A T 17: 26,190,228 Q734L probably damaging Het
Brd8 G C 18: 34,602,766 A886G probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Celf3 T C 3: 94,485,327 V35A probably damaging Het
Ckap2 T C 8: 22,175,787 T415A possibly damaging Het
Crybg3 T C 16: 59,503,237 Y1066C probably damaging Het
Csmd3 T C 15: 47,849,748 H1506R probably benign Het
Dnah10 A G 5: 124,775,203 D1808G probably damaging Het
Dsc3 C T 18: 19,980,672 G398R probably damaging Het
Emc2 A G 15: 43,527,467 Q293R probably damaging Het
Evc2 A G 5: 37,363,532 N251D possibly damaging Het
Fam151a A T 4: 106,733,915 probably benign Het
Fam208a T G 14: 27,442,554 C272W probably damaging Het
Fbxw16 T A 9: 109,441,221 I151F probably damaging Het
Fmnl2 A G 2: 53,114,868 D658G probably damaging Het
Fnip2 G A 3: 79,493,472 T314I probably benign Het
Foxc2 T A 8: 121,116,674 S20R probably damaging Het
Fpr-rs6 C T 17: 20,182,656 G148R probably damaging Het
Fsip2 T C 2: 82,992,780 S6286P possibly damaging Het
Fyb2 A T 4: 104,913,649 I54F probably benign Het
Gbf1 T C 19: 46,271,564 F999L probably damaging Het
Gldc G A 19: 30,137,113 R466* probably null Het
Gm12695 T A 4: 96,762,845 S124C probably benign Het
Gm4846 A T 1: 166,486,964 I370N possibly damaging Het
Gsdmc3 T C 15: 63,858,447 T423A probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Kcnmb3 T C 3: 32,472,343 Y233C probably damaging Het
Kidins220 A G 12: 24,994,906 D191G probably damaging Het
Kmt2a A G 9: 44,821,460 probably benign Het
Krt1 T C 15: 101,848,992 D261G probably benign Het
Lrba A G 3: 86,605,868 probably null Het
Myo1f C T 17: 33,598,172 R730* probably null Het
Ncoa7 C A 10: 30,654,430 E30* probably null Het
Neurod4 T A 10: 130,271,049 K119* probably null Het
Npy5r T C 8: 66,681,277 D288G probably benign Het
Nr3c2 A T 8: 76,909,463 I398L probably damaging Het
Olfr1002 T C 2: 85,647,746 T192A possibly damaging Het
Olfr1151 A G 2: 87,857,415 K80R probably benign Het
Olfr1160 A G 2: 88,006,304 F149S probably damaging Het
Olfr1270 T C 2: 90,149,404 S201G probably damaging Het
Olfr1277 T C 2: 111,269,593 Y258C probably damaging Het
Olfr533 C A 7: 140,466,661 F153L probably benign Het
Olfr624 A T 7: 103,670,896 I45N probably damaging Het
Olfr713 T C 7: 107,036,358 S68P probably damaging Het
Pcf11 A T 7: 92,661,601 M393K probably benign Het
Pck2 T C 14: 55,542,507 V71A probably benign Het
Pdzd8 G T 19: 59,300,122 L949I probably benign Het
Pdzrn4 G A 15: 92,746,309 probably null Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Ppid A T 3: 79,602,299 K308* probably null Het
Ppp1r1b A G 11: 98,355,363 E57G probably damaging Het
Prtg T G 9: 72,848,322 S269A probably benign Het
Rbbp5 T A 1: 132,494,297 S312T probably damaging Het
Rbm11 T A 16: 75,598,768 probably null Het
Retreg1 A G 15: 25,970,164 T139A probably damaging Het
Riok3 T A 18: 12,136,962 H120Q probably damaging Het
Rln1 A T 19: 29,334,595 M1K probably null Het
Rpp30 C T 19: 36,089,149 S94L probably damaging Het
Sccpdh C T 1: 179,684,314 P117L probably damaging Het
Serac1 T C 17: 6,048,999 K506E possibly damaging Het
Serping1 G T 2: 84,765,728 T454K probably damaging Het
Slc1a2 T A 2: 102,739,900 N174K probably damaging Het
Slc2a2 A G 3: 28,719,485 Q313R probably damaging Het
Slc46a2 T A 4: 59,914,249 S225C probably damaging Het
Smarcc2 G A 10: 128,474,758 E419K probably damaging Het
Stkld1 T A 2: 26,946,732 probably null Het
Szt2 A G 4: 118,383,965 M1704T probably benign Het
Tfcp2l1 C T 1: 118,652,923 Q116* probably null Het
Timm44 A G 8: 4,260,603 M383T possibly damaging Het
Tnpo2 G A 8: 85,045,317 probably null Het
Tnrc6b A G 15: 80,880,439 K714R probably damaging Het
Wdfy3 A G 5: 101,951,312 L290P probably damaging Het
Wdr59 A G 8: 111,451,077 F898L probably damaging Het
Zfp120 A T 2: 150,117,398 C335S probably damaging Het
Zfp518a T C 19: 40,913,510 S628P probably benign Het
Zfp879 A T 11: 50,833,528 C234S probably damaging Het
Other mutations in Phospho1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Phospho1 APN 11 95831083 missense probably damaging 0.99
IGL01950:Phospho1 APN 11 95828722 unclassified probably benign
IGL02676:Phospho1 APN 11 95830888 missense probably damaging 1.00
R2019:Phospho1 UTSW 11 95831106 missense probably damaging 0.99
R6160:Phospho1 UTSW 11 95830624 missense probably damaging 1.00
R6513:Phospho1 UTSW 11 95830687 missense possibly damaging 0.92
R7146:Phospho1 UTSW 11 95830906 missense probably damaging 1.00
R7652:Phospho1 UTSW 11 95830819 missense probably damaging 1.00
RF007:Phospho1 UTSW 11 95831055 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATGAGTACATGCAACGAGTC -3'
(R):5'- ATCACCCACGTAGAAGAGGC -3'

Sequencing Primer
(F):5'- GCAACGAGTCTTTAAGTACCTGG -3'
(R):5'- CAGGTATTCGCTGAGCACCTTG -3'
Posted On2014-08-01