Incidental Mutation 'R1965:Kidins220'
ID218305
Institutional Source Beutler Lab
Gene Symbol Kidins220
Ensembl Gene ENSMUSG00000036333
Gene Namekinase D-interacting substrate 220
SynonymsC330002I19Rik, 3110039L19Rik
MMRRC Submission 039978-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1965 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location24974925-25063152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24994906 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 191 (D191G)
Ref Sequence ENSEMBL: ENSMUSP00000152726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066652] [ENSMUST00000220459] [ENSMUST00000222941]
Predicted Effect probably damaging
Transcript: ENSMUST00000066652
AA Change: D233G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063999
Gene: ENSMUSG00000036333
AA Change: D233G

DomainStartEndE-ValueType
ANK 37 66 1.11e-7 SMART
ANK 70 99 2.25e-3 SMART
ANK 103 132 4.78e-7 SMART
ANK 136 165 5.53e-3 SMART
ANK 169 198 2.52e-6 SMART
ANK 202 231 6.26e-2 SMART
ANK 235 264 1.22e-4 SMART
ANK 268 297 6.92e-4 SMART
ANK 301 330 1.57e-2 SMART
ANK 334 363 9.78e-4 SMART
ANK 367 398 4.6e0 SMART
Pfam:KAP_NTPase 440 953 1.2e-112 PFAM
low complexity region 1077 1092 N/A INTRINSIC
low complexity region 1096 1107 N/A INTRINSIC
low complexity region 1382 1396 N/A INTRINSIC
low complexity region 1422 1452 N/A INTRINSIC
low complexity region 1509 1520 N/A INTRINSIC
low complexity region 1544 1555 N/A INTRINSIC
low complexity region 1561 1567 N/A INTRINSIC
low complexity region 1596 1609 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220459
AA Change: D191G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221378
Predicted Effect unknown
Transcript: ENSMUST00000222013
AA Change: D62G
Predicted Effect possibly damaging
Transcript: ENSMUST00000222941
AA Change: D233G

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that is preferentially expressed in the nervous system where it controls neuronal cell survival, differentiation into exons and dendrites, and synaptic plasticity. The encoded protein interacts with membrane receptors, cytosolic signaling components, and cytoskeletal proteins, serving as a scaffold that mediates crosstalk between the neurotrophin pathway and several other intracellular signaling pathways. Aberrant expression of this gene is associated with the onset of various neuropsychiatric disorders and neurodegenerative diseases, including Alzheimer's disease. Naturally occurring mutations in this gene are associated with a syndrome characterized by spastic paraplegia, intellectual disability, nystagmus and obesity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice heterozygous for a knock-out allele exhibit decreased dendritic complexity in the barrel somatosensory cortex and dentate gyrus neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik T A 5: 98,346,234 D32E probably damaging Het
1700042G07Rik G A 4: 116,174,179 C82Y probably damaging Het
Aco1 T G 4: 40,175,730 L157R probably damaging Het
Acot11 A T 4: 106,749,353 L513Q probably damaging Het
Amd1 A G 10: 40,294,759 I52T probably benign Het
Ap2b1 T C 11: 83,346,895 I557T probably benign Het
Arel1 T A 12: 84,940,399 probably null Het
Arg1 T A 10: 24,916,864 probably null Het
Atf1 A T 15: 100,254,171 M135L probably benign Het
Atf2 T C 2: 73,850,898 E77G possibly damaging Het
Axin1 G T 17: 26,184,225 A394S probably damaging Het
Axin1 A T 17: 26,190,228 Q734L probably damaging Het
Brd8 G C 18: 34,602,766 A886G probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Celf3 T C 3: 94,485,327 V35A probably damaging Het
Ckap2 T C 8: 22,175,787 T415A possibly damaging Het
Crybg3 T C 16: 59,503,237 Y1066C probably damaging Het
Csmd3 T C 15: 47,849,748 H1506R probably benign Het
Dnah10 A G 5: 124,775,203 D1808G probably damaging Het
Dsc3 C T 18: 19,980,672 G398R probably damaging Het
Emc2 A G 15: 43,527,467 Q293R probably damaging Het
Evc2 A G 5: 37,363,532 N251D possibly damaging Het
Fam151a A T 4: 106,733,915 probably benign Het
Fam208a T G 14: 27,442,554 C272W probably damaging Het
Fbxw16 T A 9: 109,441,221 I151F probably damaging Het
Fmnl2 A G 2: 53,114,868 D658G probably damaging Het
Fnip2 G A 3: 79,493,472 T314I probably benign Het
Foxc2 T A 8: 121,116,674 S20R probably damaging Het
Fpr-rs6 C T 17: 20,182,656 G148R probably damaging Het
Fsip2 T C 2: 82,992,780 S6286P possibly damaging Het
Fyb2 A T 4: 104,913,649 I54F probably benign Het
Gbf1 T C 19: 46,271,564 F999L probably damaging Het
Gldc G A 19: 30,137,113 R466* probably null Het
Gm12695 T A 4: 96,762,845 S124C probably benign Het
Gm4846 A T 1: 166,486,964 I370N possibly damaging Het
Gsdmc3 T C 15: 63,858,447 T423A probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Kcnmb3 T C 3: 32,472,343 Y233C probably damaging Het
Kmt2a A G 9: 44,821,460 probably benign Het
Krt1 T C 15: 101,848,992 D261G probably benign Het
Lrba A G 3: 86,605,868 probably null Het
Myo1f C T 17: 33,598,172 R730* probably null Het
Ncoa7 C A 10: 30,654,430 E30* probably null Het
Neurod4 T A 10: 130,271,049 K119* probably null Het
Npy5r T C 8: 66,681,277 D288G probably benign Het
Nr3c2 A T 8: 76,909,463 I398L probably damaging Het
Olfr1002 T C 2: 85,647,746 T192A possibly damaging Het
Olfr1151 A G 2: 87,857,415 K80R probably benign Het
Olfr1160 A G 2: 88,006,304 F149S probably damaging Het
Olfr1270 T C 2: 90,149,404 S201G probably damaging Het
Olfr1277 T C 2: 111,269,593 Y258C probably damaging Het
Olfr533 C A 7: 140,466,661 F153L probably benign Het
Olfr624 A T 7: 103,670,896 I45N probably damaging Het
Olfr713 T C 7: 107,036,358 S68P probably damaging Het
Pcf11 A T 7: 92,661,601 M393K probably benign Het
Pck2 T C 14: 55,542,507 V71A probably benign Het
Pdzd8 G T 19: 59,300,122 L949I probably benign Het
Pdzrn4 G A 15: 92,746,309 probably null Het
Phospho1 A G 11: 95,830,879 N125S probably damaging Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Ppid A T 3: 79,602,299 K308* probably null Het
Ppp1r1b A G 11: 98,355,363 E57G probably damaging Het
Prtg T G 9: 72,848,322 S269A probably benign Het
Rbbp5 T A 1: 132,494,297 S312T probably damaging Het
Rbm11 T A 16: 75,598,768 probably null Het
Retreg1 A G 15: 25,970,164 T139A probably damaging Het
Riok3 T A 18: 12,136,962 H120Q probably damaging Het
Rln1 A T 19: 29,334,595 M1K probably null Het
Rpp30 C T 19: 36,089,149 S94L probably damaging Het
Sccpdh C T 1: 179,684,314 P117L probably damaging Het
Serac1 T C 17: 6,048,999 K506E possibly damaging Het
Serping1 G T 2: 84,765,728 T454K probably damaging Het
Slc1a2 T A 2: 102,739,900 N174K probably damaging Het
Slc2a2 A G 3: 28,719,485 Q313R probably damaging Het
Slc46a2 T A 4: 59,914,249 S225C probably damaging Het
Smarcc2 G A 10: 128,474,758 E419K probably damaging Het
Stkld1 T A 2: 26,946,732 probably null Het
Szt2 A G 4: 118,383,965 M1704T probably benign Het
Tfcp2l1 C T 1: 118,652,923 Q116* probably null Het
Timm44 A G 8: 4,260,603 M383T possibly damaging Het
Tnpo2 G A 8: 85,045,317 probably null Het
Tnrc6b A G 15: 80,880,439 K714R probably damaging Het
Wdfy3 A G 5: 101,951,312 L290P probably damaging Het
Wdr59 A G 8: 111,451,077 F898L probably damaging Het
Zfp120 A T 2: 150,117,398 C335S probably damaging Het
Zfp518a T C 19: 40,913,510 S628P probably benign Het
Zfp879 A T 11: 50,833,528 C234S probably damaging Het
Other mutations in Kidins220
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Kidins220 APN 12 25038560 splice site probably benign
IGL00959:Kidins220 APN 12 25051133 missense possibly damaging 0.74
IGL00978:Kidins220 APN 12 25057474 missense probably damaging 1.00
IGL01144:Kidins220 APN 12 25010926 missense probably damaging 1.00
IGL01326:Kidins220 APN 12 25038499 missense probably damaging 0.97
IGL01545:Kidins220 APN 12 25040460 missense possibly damaging 0.66
IGL01802:Kidins220 APN 12 24995000 missense probably damaging 1.00
IGL01875:Kidins220 APN 12 25057729 missense probably benign 0.00
IGL02160:Kidins220 APN 12 25004111 missense probably damaging 1.00
IGL02383:Kidins220 APN 12 24997333 splice site probably benign
IGL02673:Kidins220 APN 12 24994992 missense probably damaging 1.00
IGL02800:Kidins220 APN 12 25003093 missense probably damaging 1.00
IGL03345:Kidins220 APN 12 25003045 missense probably damaging 1.00
IGL03379:Kidins220 APN 12 25008448 missense probably damaging 0.99
IGL03412:Kidins220 APN 12 24999345 missense probably damaging 1.00
P0043:Kidins220 UTSW 12 25008156 missense probably damaging 1.00
R0011:Kidins220 UTSW 12 24999352 missense probably damaging 0.99
R0011:Kidins220 UTSW 12 24999352 missense probably damaging 0.99
R0269:Kidins220 UTSW 12 25040512 missense probably damaging 0.98
R0280:Kidins220 UTSW 12 25010141 missense probably damaging 1.00
R0334:Kidins220 UTSW 12 25008069 missense probably damaging 1.00
R1601:Kidins220 UTSW 12 25005088 missense probably benign 0.35
R1778:Kidins220 UTSW 12 25013446 splice site probably benign
R1808:Kidins220 UTSW 12 25003009 missense probably benign 0.00
R1855:Kidins220 UTSW 12 25056591 missense probably damaging 1.00
R1982:Kidins220 UTSW 12 25051194 missense probably benign 0.01
R2069:Kidins220 UTSW 12 24987006 splice site probably benign
R2101:Kidins220 UTSW 12 25057423 missense probably damaging 1.00
R2124:Kidins220 UTSW 12 25041303 critical splice donor site probably null
R2371:Kidins220 UTSW 12 25057324 missense probably damaging 1.00
R2405:Kidins220 UTSW 12 25011509 missense probably damaging 0.99
R3522:Kidins220 UTSW 12 24990758 missense probably damaging 1.00
R3877:Kidins220 UTSW 12 25001565 splice site probably benign
R3915:Kidins220 UTSW 12 25053958 missense possibly damaging 0.93
R4023:Kidins220 UTSW 12 25057144 splice site probably null
R4287:Kidins220 UTSW 12 25056846 missense possibly damaging 0.81
R4476:Kidins220 UTSW 12 25011001 missense probably damaging 1.00
R4495:Kidins220 UTSW 12 25038302 splice site probably null
R4627:Kidins220 UTSW 12 25057042 missense possibly damaging 0.89
R4807:Kidins220 UTSW 12 25057285 missense probably damaging 1.00
R4899:Kidins220 UTSW 12 25013443 critical splice donor site probably null
R4960:Kidins220 UTSW 12 24992260 nonsense probably null
R5118:Kidins220 UTSW 12 24992297 missense probably damaging 1.00
R5183:Kidins220 UTSW 12 25051126 missense probably benign 0.17
R5238:Kidins220 UTSW 12 25003010 missense probably benign 0.31
R5580:Kidins220 UTSW 12 25047897 missense probably benign 0.00
R5707:Kidins220 UTSW 12 25013391 missense probably damaging 1.00
R5813:Kidins220 UTSW 12 25057140 nonsense probably null
R6131:Kidins220 UTSW 12 24992314 splice site probably null
R6146:Kidins220 UTSW 12 25052813 missense probably damaging 1.00
R6151:Kidins220 UTSW 12 25056909 missense possibly damaging 0.65
R6160:Kidins220 UTSW 12 24997311 missense probably damaging 1.00
R6187:Kidins220 UTSW 12 25051308 splice site probably null
R6289:Kidins220 UTSW 12 25056616 missense probably damaging 1.00
R6321:Kidins220 UTSW 12 25057534 missense probably benign 0.09
R6450:Kidins220 UTSW 12 25057191 missense probably benign
R6513:Kidins220 UTSW 12 25038435 missense possibly damaging 0.94
R6652:Kidins220 UTSW 12 25010060 splice site probably null
R6711:Kidins220 UTSW 12 24998751 missense probably damaging 0.96
R6858:Kidins220 UTSW 12 25008543 missense possibly damaging 0.85
R7102:Kidins220 UTSW 12 25057663 missense probably benign 0.00
R7112:Kidins220 UTSW 12 25004019 missense probably damaging 1.00
R7139:Kidins220 UTSW 12 24994821 missense probably damaging 1.00
R7140:Kidins220 UTSW 12 25036624 missense probably damaging 1.00
R7271:Kidins220 UTSW 12 25011571 missense probably benign 0.21
R7361:Kidins220 UTSW 12 25057000 missense probably benign 0.01
R7509:Kidins220 UTSW 12 24982361 missense probably damaging 0.98
R7510:Kidins220 UTSW 12 24992269 missense possibly damaging 0.88
R7783:Kidins220 UTSW 12 24988556 missense probably damaging 1.00
R7796:Kidins220 UTSW 12 24982351 missense probably damaging 0.96
R7831:Kidins220 UTSW 12 25061231 missense possibly damaging 0.90
R8074:Kidins220 UTSW 12 25057716 missense probably benign 0.29
R8214:Kidins220 UTSW 12 24994855 missense probably damaging 1.00
R8304:Kidins220 UTSW 12 25057128 missense probably benign 0.01
R8313:Kidins220 UTSW 12 25004111 missense probably damaging 1.00
R8346:Kidins220 UTSW 12 25036534 missense probably damaging 1.00
R8392:Kidins220 UTSW 12 24990728 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCTCACCTGCTTGAAAATAG -3'
(R):5'- ACCCTACGTGTGACATTTCTAGTAAC -3'

Sequencing Primer
(F):5'- AGCTCACCTGCTTGAAAATAGTTTTC -3'
(R):5'- CGTGTGACATTTCTAGTAACCAAAC -3'
Posted On2014-08-01