Incidental Mutation 'R0142:Jph3'
ID22385
Institutional Source Beutler Lab
Gene Symbol Jph3
Ensembl Gene ENSMUSG00000025318
Gene Namejunctophilin 3
SynonymsJP-3
MMRRC Submission 038427-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R0142 (G1)
Quality Score162
Status Validated (trace)
Chromosome8
Chromosomal Location121729623-121794276 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121753371 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 263 (T263A)
Ref Sequence ENSEMBL: ENSMUSP00000126190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026357] [ENSMUST00000127664] [ENSMUST00000167439]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026357
AA Change: T263A

PolyPhen 2 Score 0.844 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000026357
Gene: ENSMUSG00000025318
AA Change: T263A

DomainStartEndE-ValueType
MORN 13 34 8.01e-1 SMART
MORN 37 57 6.13e1 SMART
MORN 59 80 2.99e-1 SMART
Pfam:MORN 83 104 5.9e-2 PFAM
MORN 105 126 8.1e-5 SMART
MORN 128 149 2.74e-2 SMART
low complexity region 181 192 N/A INTRINSIC
low complexity region 212 244 N/A INTRINSIC
MORN 286 307 2.78e-3 SMART
MORN 309 330 1.03e-6 SMART
low complexity region 360 381 N/A INTRINSIC
low complexity region 393 409 N/A INTRINSIC
low complexity region 481 494 N/A INTRINSIC
transmembrane domain 721 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167439
AA Change: T263A

PolyPhen 2 Score 0.844 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126190
Gene: ENSMUSG00000025318
AA Change: T263A

DomainStartEndE-ValueType
MORN 13 34 8.01e-1 SMART
MORN 37 57 6.13e1 SMART
MORN 59 80 2.99e-1 SMART
Pfam:MORN 83 104 5.8e-2 PFAM
MORN 105 126 8.1e-5 SMART
MORN 128 149 2.74e-2 SMART
low complexity region 181 192 N/A INTRINSIC
low complexity region 212 244 N/A INTRINSIC
MORN 286 307 2.78e-3 SMART
MORN 309 330 1.03e-6 SMART
low complexity region 360 381 N/A INTRINSIC
low complexity region 393 409 N/A INTRINSIC
low complexity region 481 494 N/A INTRINSIC
transmembrane domain 721 743 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172209
Meta Mutation Damage Score 0.0874 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 87.6%
Validation Efficiency 92% (61/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Junctional complexes between the plasma membrane and endoplasmic/sarcoplasmic reticulum are a common feature of all excitable cell types and mediate cross talk between cell surface and intracellular ion channels. The protein encoded by this gene is a component of junctional complexes and is composed of a C-terminal hydrophobic segment spanning the endoplasmic/sarcoplasmic reticulum membrane and a remaining cytoplasmic domain that shows specific affinity for the plasma membrane. CAG/CTG repeat expansion from normally 6-28 repeats to 40-59 repeats in the 3' UTR of this gene have been associated with Huntington disease-like 2 (HDL2). This gene is a member of the junctophilin gene family. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired balance and motor coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A G 19: 29,718,254 S1347P possibly damaging Het
Abca6 T G 11: 110,188,641 D1229A probably damaging Het
Abhd8 A C 8: 71,461,862 F41V probably damaging Het
Ago4 T G 4: 126,516,932 E222A probably benign Het
Ap3b2 T C 7: 81,473,080 I470V probably damaging Het
Bcl9l C T 9: 44,507,112 T749M probably benign Het
Bicc1 T C 10: 70,925,370 K937E probably damaging Het
Bmi1 G A 2: 18,683,284 probably null Het
Boc A C 16: 44,490,241 I772S probably damaging Het
C2 T A 17: 34,873,528 I178F possibly damaging Het
Cacna1c G T 6: 118,603,882 A1416E probably damaging Het
Chst10 A G 1: 38,871,729 L118P probably damaging Het
Crybg1 G A 10: 43,999,063 T683I possibly damaging Het
Cul5 C T 9: 53,635,050 V314I probably damaging Het
Dnajc17 C A 2: 119,179,934 R211I probably benign Het
Emilin1 A G 5: 30,913,920 T16A probably benign Het
Ercc6l2 A C 13: 63,872,506 probably benign Het
Fsd2 T A 7: 81,559,935 D53V probably damaging Het
Galnt13 A G 2: 55,098,603 D479G probably damaging Het
Grk3 A T 5: 112,915,053 W643R probably damaging Het
Hdgf G A 3: 87,913,109 A4T possibly damaging Het
Hnrnpr T A 4: 136,327,282 V182E probably damaging Het
Ipo13 A C 4: 117,905,569 L279R probably damaging Het
Itga9 C A 9: 118,636,586 N169K probably damaging Het
Jph4 G T 14: 55,108,326 Q625K probably benign Het
Kctd3 A C 1: 188,996,398 probably null Het
Kif26b A T 1: 178,915,389 S570C probably damaging Het
Klhl5 G A 5: 65,143,350 W164* probably null Het
Lacc1 A T 14: 77,030,799 H357Q probably benign Het
Lama2 A G 10: 27,187,845 I1316T probably benign Het
Lcp2 C T 11: 34,082,418 P332L probably damaging Het
Map3k6 A T 4: 133,250,946 H1033L probably benign Het
Mfsd2b A G 12: 4,866,234 V252A probably benign Het
Myo16 T A 8: 10,569,790 I1447N probably benign Het
Myo19 G A 11: 84,894,603 R224H probably damaging Het
Myo5a C T 9: 75,160,574 H637Y probably benign Het
Nek10 C T 14: 14,861,560 R539C possibly damaging Het
Nfix A T 8: 84,721,686 V404E probably damaging Het
Nr1i2 T C 16: 38,253,006 R203G probably benign Het
Nup210l G A 3: 90,172,113 G968D probably damaging Het
Olfr1494 A T 19: 13,749,255 I50F probably benign Het
Olfr697 G T 7: 106,741,765 H56Q probably benign Het
Olfr884 A T 9: 38,048,110 H296L probably benign Het
Phlpp2 C T 8: 109,907,513 R242W probably damaging Het
Plcz1 A G 6: 140,007,697 F398S probably damaging Het
Ppfibp2 C A 7: 107,744,177 P808T probably damaging Het
Srpk2 T C 5: 23,527,930 K239E probably damaging Het
Svep1 A G 4: 58,118,232 V830A probably benign Het
Tesc A T 5: 118,056,570 I149F possibly damaging Het
Thsd7a A G 6: 12,418,335 W632R probably damaging Het
Tmprss9 A G 10: 80,894,378 D704G possibly damaging Het
Tob1 T C 11: 94,214,597 Y320H probably damaging Het
Trpm3 G T 19: 22,987,916 D1582Y probably damaging Het
Ttc28 A G 5: 111,277,457 K1716R probably benign Het
Uqcrfs1 A G 13: 30,540,942 V205A probably benign Het
Usp29 G A 7: 6,962,335 M392I probably benign Het
Uspl1 A T 5: 149,188,349 Y22F possibly damaging Het
Virma C A 4: 11,548,783 N1780K probably benign Het
Vmn1r56 C T 7: 5,196,373 A82T probably benign Het
Vmn2r5 A T 3: 64,492,588 C553S probably damaging Het
Vwce A T 19: 10,664,612 R901W probably damaging Het
Wdpcp C A 11: 21,857,444 probably null Het
Zfp423 A T 8: 87,780,340 C1000* probably null Het
Zscan20 A G 4: 128,585,837 F954L probably benign Het
Other mutations in Jph3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02976:Jph3 APN 8 121753084 missense probably damaging 1.00
R0200:Jph3 UTSW 8 121784833 missense probably benign 0.36
R0238:Jph3 UTSW 8 121753720 missense possibly damaging 0.83
R0238:Jph3 UTSW 8 121753720 missense possibly damaging 0.83
R1550:Jph3 UTSW 8 121784859 missense possibly damaging 0.74
R2127:Jph3 UTSW 8 121785142 missense probably benign 0.09
R2160:Jph3 UTSW 8 121753231 missense possibly damaging 0.50
R3901:Jph3 UTSW 8 121753419 missense possibly damaging 0.64
R3902:Jph3 UTSW 8 121753419 missense possibly damaging 0.64
R5126:Jph3 UTSW 8 121753048 missense possibly damaging 0.70
R6073:Jph3 UTSW 8 121753552 missense probably damaging 1.00
R6130:Jph3 UTSW 8 121753087 missense probably damaging 0.98
R6794:Jph3 UTSW 8 121785385 missense probably benign 0.10
R6923:Jph3 UTSW 8 121753371 missense possibly damaging 0.84
R7337:Jph3 UTSW 8 121753702 missense probably benign 0.03
R7897:Jph3 UTSW 8 121789397 critical splice acceptor site probably null
R8041:Jph3 UTSW 8 121789462 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TTATGGCATGGCCGCAGTCATC -3'
(R):5'- AGCGATCTCGGCTTTCTGCTTG -3'

Sequencing Primer
(F):5'- CAGTGACTCGGAGATCCTCAAG -3'
(R):5'- TCGGGGAAAGTCATGCACC -3'
Posted On2013-04-16