Incidental Mutation 'R8041:Jph3'
ID618530
Institutional Source Beutler Lab
Gene Symbol Jph3
Ensembl Gene ENSMUSG00000025318
Gene Namejunctophilin 3
SynonymsJP-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R8041 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location121729623-121794276 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 121789462 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 740 (I740L)
Ref Sequence ENSEMBL: ENSMUSP00000026357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026357] [ENSMUST00000127664] [ENSMUST00000167439]
Predicted Effect probably benign
Transcript: ENSMUST00000026357
AA Change: I740L

PolyPhen 2 Score 0.377 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000026357
Gene: ENSMUSG00000025318
AA Change: I740L

DomainStartEndE-ValueType
MORN 13 34 8.01e-1 SMART
MORN 37 57 6.13e1 SMART
MORN 59 80 2.99e-1 SMART
Pfam:MORN 83 104 5.9e-2 PFAM
MORN 105 126 8.1e-5 SMART
MORN 128 149 2.74e-2 SMART
low complexity region 181 192 N/A INTRINSIC
low complexity region 212 244 N/A INTRINSIC
MORN 286 307 2.78e-3 SMART
MORN 309 330 1.03e-6 SMART
low complexity region 360 381 N/A INTRINSIC
low complexity region 393 409 N/A INTRINSIC
low complexity region 481 494 N/A INTRINSIC
transmembrane domain 721 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167439
AA Change: I740L

PolyPhen 2 Score 0.377 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126190
Gene: ENSMUSG00000025318
AA Change: I740L

DomainStartEndE-ValueType
MORN 13 34 8.01e-1 SMART
MORN 37 57 6.13e1 SMART
MORN 59 80 2.99e-1 SMART
Pfam:MORN 83 104 5.8e-2 PFAM
MORN 105 126 8.1e-5 SMART
MORN 128 149 2.74e-2 SMART
low complexity region 181 192 N/A INTRINSIC
low complexity region 212 244 N/A INTRINSIC
MORN 286 307 2.78e-3 SMART
MORN 309 330 1.03e-6 SMART
low complexity region 360 381 N/A INTRINSIC
low complexity region 393 409 N/A INTRINSIC
low complexity region 481 494 N/A INTRINSIC
transmembrane domain 721 743 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Junctional complexes between the plasma membrane and endoplasmic/sarcoplasmic reticulum are a common feature of all excitable cell types and mediate cross talk between cell surface and intracellular ion channels. The protein encoded by this gene is a component of junctional complexes and is composed of a C-terminal hydrophobic segment spanning the endoplasmic/sarcoplasmic reticulum membrane and a remaining cytoplasmic domain that shows specific affinity for the plasma membrane. CAG/CTG repeat expansion from normally 6-28 repeats to 40-59 repeats in the 3' UTR of this gene have been associated with Huntington disease-like 2 (HDL2). This gene is a member of the junctophilin gene family. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired balance and motor coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G C 13: 63,033,107 W294C probably damaging Het
5830473C10Rik T A 5: 90,593,005 probably null Het
Afap1l1 A T 18: 61,758,683 L21Q probably damaging Het
Ago1 G A 4: 126,441,936 R661C probably damaging Het
Aoc3 T C 11: 101,332,306 V456A probably benign Het
Cacna1b A T 2: 24,657,299 F1223L probably damaging Het
Ccdc40 T C 11: 119,231,681 F33S possibly damaging Het
Ccnjl T C 11: 43,579,711 V102A probably damaging Het
Cd48 T C 1: 171,699,390 V128A probably damaging Het
Cmah A G 13: 24,468,618 D577G probably benign Het
Cnnm4 A G 1: 36,472,093 K134R probably benign Het
Cntnap5a T A 1: 116,259,479 Y594N probably damaging Het
Col14a1 A G 15: 55,455,230 E1375G unknown Het
Comtd1 T A 14: 21,847,917 E153V probably benign Het
Dchs1 T A 7: 105,755,188 T2716S probably benign Het
Ddx4 A T 13: 112,626,394 S143T probably benign Het
Dlg1 A G 16: 31,838,067 D593G possibly damaging Het
Dok6 A G 18: 89,560,089 I68T possibly damaging Het
Dpysl5 A G 5: 30,796,314 I563V probably benign Het
Eapp A G 12: 54,692,865 S56P probably damaging Het
Fgd5 A T 6: 92,061,856 D1157V probably damaging Het
Fmn1 T A 2: 113,364,594 L213Q unknown Het
Foxo1 T A 3: 52,345,623 Y402* probably null Het
Fyb2 C A 4: 105,000,484 F619L possibly damaging Het
Gm11639 T G 11: 104,919,479 D3147E unknown Het
Gtf2i A T 5: 134,293,745 probably null Het
Hrh1 G A 6: 114,479,917 R53H not run Het
Hydin A T 8: 110,574,994 M3786L probably benign Het
Ifi207 T C 1: 173,727,702 R805G possibly damaging Het
Igfn1 C A 1: 135,968,059 G1590* probably null Het
Kbtbd7 T A 14: 79,428,704 F659I probably benign Het
Kcns2 A T 15: 34,839,145 Q218L probably benign Het
Kcnt2 A G 1: 140,609,660 N1119S probably benign Het
Krit1 A T 5: 3,807,309 H38L probably benign Het
Krt20 T A 11: 99,437,837 R87S probably damaging Het
Ly6g5c A G 17: 35,111,832 E110G probably damaging Het
Mamdc4 A G 2: 25,564,695 F1035S probably damaging Het
Mmp13 A T 9: 7,280,865 D416V probably benign Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nrap A T 19: 56,364,336 L566* probably null Het
Olfr109 T C 17: 37,466,649 F148L probably benign Het
Olfr1271 A T 2: 90,266,144 C95* probably null Het
Olfr494 T C 7: 108,367,534 F15L probably damaging Het
Olfr632 T C 7: 103,937,581 L67P probably damaging Het
Pcdhb19 T C 18: 37,497,314 L54P possibly damaging Het
Pitpnm2 A G 5: 124,121,456 F1272S probably damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Reep4 T C 14: 70,548,187 Y186H probably benign Het
Rpgrip1 A G 14: 52,119,245 T89A possibly damaging Het
Shc1 T C 3: 89,422,953 S175P probably damaging Het
Sipa1l3 A G 7: 29,364,220 S1156P probably damaging Het
Slc1a3 G A 15: 8,636,199 P522L probably benign Het
Slc6a17 T A 3: 107,474,428 T446S probably damaging Het
Tas1r2 A T 4: 139,659,979 N250Y possibly damaging Het
Tex15 G T 8: 33,575,846 R1768L probably damaging Het
Ttll9 G C 2: 153,003,036 Q441H possibly damaging Het
Unc5c T A 3: 141,465,784 V24E possibly damaging Het
Unc79 A G 12: 103,088,467 E888G probably benign Het
Vmn2r19 T C 6: 123,335,791 S607P possibly damaging Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Wdfy4 A G 14: 33,154,008 probably null Het
Zbtb49 T C 5: 38,200,854 D685G possibly damaging Het
Other mutations in Jph3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02976:Jph3 APN 8 121753084 missense probably damaging 1.00
R0142:Jph3 UTSW 8 121753371 missense possibly damaging 0.84
R0200:Jph3 UTSW 8 121784833 missense probably benign 0.36
R0238:Jph3 UTSW 8 121753720 missense possibly damaging 0.83
R0238:Jph3 UTSW 8 121753720 missense possibly damaging 0.83
R1550:Jph3 UTSW 8 121784859 missense possibly damaging 0.74
R2127:Jph3 UTSW 8 121785142 missense probably benign 0.09
R2160:Jph3 UTSW 8 121753231 missense possibly damaging 0.50
R3901:Jph3 UTSW 8 121753419 missense possibly damaging 0.64
R3902:Jph3 UTSW 8 121753419 missense possibly damaging 0.64
R5126:Jph3 UTSW 8 121753048 missense possibly damaging 0.70
R6073:Jph3 UTSW 8 121753552 missense probably damaging 1.00
R6130:Jph3 UTSW 8 121753087 missense probably damaging 0.98
R6794:Jph3 UTSW 8 121785385 missense probably benign 0.10
R6923:Jph3 UTSW 8 121753371 missense possibly damaging 0.84
R7337:Jph3 UTSW 8 121753702 missense probably benign 0.03
R7897:Jph3 UTSW 8 121789397 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GTTAGAGCTTCCCACCAGGTTG -3'
(R):5'- TTCCAGGCCACACAGCATTG -3'

Sequencing Primer
(F):5'- TTCCCACCAGGTTGAGGAAGAC -3'
(R):5'- CAAGCAAAGAATTTTGGCTAAAATCC -3'
Posted On2020-01-23