Incidental Mutation 'R0142:Thsd7a'
ID22374
Institutional Source Beutler Lab
Gene Symbol Thsd7a
Ensembl Gene ENSMUSG00000032625
Gene Namethrombospondin, type I, domain containing 7A
SynonymsLOC330267
MMRRC Submission 038427-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0142 (G1)
Quality Score225
Status Validated (trace)
Chromosome6
Chromosomal Location12311610-12749410 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12418335 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 632 (W632R)
Ref Sequence ENSEMBL: ENSMUSP00000131662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119581] [ENSMUST00000172356]
Predicted Effect probably damaging
Transcript: ENSMUST00000046121
AA Change: W632R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040176
Gene: ENSMUSG00000032625
AA Change: W632R

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
TSP1 49 105 4.88e0 SMART
TSP1 186 236 1.58e-16 SMART
low complexity region 264 278 N/A INTRINSIC
low complexity region 290 304 N/A INTRINSIC
TSP1 352 408 9.98e-5 SMART
TSP1 415 499 3.14e0 SMART
TSP1 504 563 6.62e-1 SMART
TSP1 626 684 1.24e-9 SMART
TSP1 687 758 1.48e0 SMART
TSP1 763 820 6.24e-6 SMART
TSP1 898 948 7.31e-2 SMART
TSP1 1027 1084 1.2e-7 SMART
TSP1 1087 1152 5.82e-1 SMART
TSP1 1157 1209 4.24e-2 SMART
TSP1 1212 1273 1e0 SMART
TSP1 1278 1330 3.55e-10 SMART
TSP1 1331 1401 7.5e-2 SMART
TSP1 1406 1464 1.55e-1 SMART
transmembrane domain 1596 1618 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119581
AA Change: W632R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113681
Gene: ENSMUSG00000032625
AA Change: W632R

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
TSP1 49 105 4.88e0 SMART
TSP1 186 236 1.58e-16 SMART
low complexity region 264 278 N/A INTRINSIC
low complexity region 290 304 N/A INTRINSIC
TSP1 352 408 9.98e-5 SMART
TSP1 415 499 3.14e0 SMART
TSP1 504 563 6.62e-1 SMART
TSP1 626 684 1.24e-9 SMART
TSP1 687 758 1.48e0 SMART
TSP1 763 820 6.24e-6 SMART
TSP1 898 948 7.31e-2 SMART
TSP1 1027 1082 9.09e-8 SMART
TSP1 1085 1150 5.82e-1 SMART
TSP1 1155 1207 4.24e-2 SMART
TSP1 1210 1271 1e0 SMART
TSP1 1276 1328 3.55e-10 SMART
TSP1 1329 1399 7.5e-2 SMART
TSP1 1404 1462 1.55e-1 SMART
transmembrane domain 1594 1616 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122369
SMART Domains Protein: ENSMUSP00000112503
Gene: ENSMUSG00000032625

DomainStartEndE-ValueType
TSP1 43 100 6.24e-6 SMART
TSP1 178 228 7.31e-2 SMART
Blast:TSP1 232 302 4e-26 BLAST
TSP1 307 362 9.09e-8 SMART
TSP1 365 430 5.82e-1 SMART
TSP1 435 487 4.24e-2 SMART
TSP1 490 551 1e0 SMART
TSP1 556 608 3.55e-10 SMART
TSP1 609 679 7.5e-2 SMART
TSP1 684 742 1.55e-1 SMART
transmembrane domain 874 896 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172356
AA Change: W632R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131662
Gene: ENSMUSG00000032625
AA Change: W632R

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
TSP1 49 105 4.88e0 SMART
TSP1 186 236 1.58e-16 SMART
low complexity region 264 278 N/A INTRINSIC
low complexity region 290 304 N/A INTRINSIC
TSP1 352 408 9.98e-5 SMART
TSP1 415 499 3.14e0 SMART
TSP1 504 563 6.62e-1 SMART
TSP1 626 684 1.24e-9 SMART
TSP1 687 758 1.48e0 SMART
TSP1 763 820 6.24e-6 SMART
TSP1 898 948 7.31e-2 SMART
TSP1 1027 1084 1.95e-7 SMART
TSP1 1087 1152 5.82e-1 SMART
TSP1 1157 1209 4.24e-2 SMART
TSP1 1212 1273 1e0 SMART
TSP1 1278 1330 3.55e-10 SMART
TSP1 1331 1401 7.5e-2 SMART
TSP1 1406 1464 1.55e-1 SMART
transmembrane domain 1596 1618 N/A INTRINSIC
Meta Mutation Damage Score 0.9497 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 87.6%
Validation Efficiency 92% (61/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found almost exclusively in endothelial cells from placenta and umbilical cord. The encoded protein appears to interact with alpha(V)beta(3) integrin and paxillin to inhibit endothelial cell migration and tube formation. This protein may be involved in cytoskeletal organization. Variations in this gene may be associated with low bone mineral density in osteoporosis. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A G 19: 29,718,254 S1347P possibly damaging Het
Abca6 T G 11: 110,188,641 D1229A probably damaging Het
Abhd8 A C 8: 71,461,862 F41V probably damaging Het
Ago4 T G 4: 126,516,932 E222A probably benign Het
Ap3b2 T C 7: 81,473,080 I470V probably damaging Het
Bcl9l C T 9: 44,507,112 T749M probably benign Het
Bicc1 T C 10: 70,925,370 K937E probably damaging Het
Bmi1 G A 2: 18,683,284 probably null Het
Boc A C 16: 44,490,241 I772S probably damaging Het
C2 T A 17: 34,873,528 I178F possibly damaging Het
Cacna1c G T 6: 118,603,882 A1416E probably damaging Het
Chst10 A G 1: 38,871,729 L118P probably damaging Het
Crybg1 G A 10: 43,999,063 T683I possibly damaging Het
Cul5 C T 9: 53,635,050 V314I probably damaging Het
Dnajc17 C A 2: 119,179,934 R211I probably benign Het
Emilin1 A G 5: 30,913,920 T16A probably benign Het
Ercc6l2 A C 13: 63,872,506 probably benign Het
Fsd2 T A 7: 81,559,935 D53V probably damaging Het
Galnt13 A G 2: 55,098,603 D479G probably damaging Het
Grk3 A T 5: 112,915,053 W643R probably damaging Het
Hdgf G A 3: 87,913,109 A4T possibly damaging Het
Hnrnpr T A 4: 136,327,282 V182E probably damaging Het
Ipo13 A C 4: 117,905,569 L279R probably damaging Het
Itga9 C A 9: 118,636,586 N169K probably damaging Het
Jph3 A G 8: 121,753,371 T263A possibly damaging Het
Jph4 G T 14: 55,108,326 Q625K probably benign Het
Kctd3 A C 1: 188,996,398 probably null Het
Kif26b A T 1: 178,915,389 S570C probably damaging Het
Klhl5 G A 5: 65,143,350 W164* probably null Het
Lacc1 A T 14: 77,030,799 H357Q probably benign Het
Lama2 A G 10: 27,187,845 I1316T probably benign Het
Lcp2 C T 11: 34,082,418 P332L probably damaging Het
Map3k6 A T 4: 133,250,946 H1033L probably benign Het
Mfsd2b A G 12: 4,866,234 V252A probably benign Het
Myo16 T A 8: 10,569,790 I1447N probably benign Het
Myo19 G A 11: 84,894,603 R224H probably damaging Het
Myo5a C T 9: 75,160,574 H637Y probably benign Het
Nek10 C T 14: 14,861,560 R539C possibly damaging Het
Nfix A T 8: 84,721,686 V404E probably damaging Het
Nr1i2 T C 16: 38,253,006 R203G probably benign Het
Nup210l G A 3: 90,172,113 G968D probably damaging Het
Olfr1494 A T 19: 13,749,255 I50F probably benign Het
Olfr697 G T 7: 106,741,765 H56Q probably benign Het
Olfr884 A T 9: 38,048,110 H296L probably benign Het
Phlpp2 C T 8: 109,907,513 R242W probably damaging Het
Plcz1 A G 6: 140,007,697 F398S probably damaging Het
Ppfibp2 C A 7: 107,744,177 P808T probably damaging Het
Srpk2 T C 5: 23,527,930 K239E probably damaging Het
Svep1 A G 4: 58,118,232 V830A probably benign Het
Tesc A T 5: 118,056,570 I149F possibly damaging Het
Tmprss9 A G 10: 80,894,378 D704G possibly damaging Het
Tob1 T C 11: 94,214,597 Y320H probably damaging Het
Trpm3 G T 19: 22,987,916 D1582Y probably damaging Het
Ttc28 A G 5: 111,277,457 K1716R probably benign Het
Uqcrfs1 A G 13: 30,540,942 V205A probably benign Het
Usp29 G A 7: 6,962,335 M392I probably benign Het
Uspl1 A T 5: 149,188,349 Y22F possibly damaging Het
Virma C A 4: 11,548,783 N1780K probably benign Het
Vmn1r56 C T 7: 5,196,373 A82T probably benign Het
Vmn2r5 A T 3: 64,492,588 C553S probably damaging Het
Vwce A T 19: 10,664,612 R901W probably damaging Het
Wdpcp C A 11: 21,857,444 probably null Het
Zfp423 A T 8: 87,780,340 C1000* probably null Het
Zscan20 A G 4: 128,585,837 F954L probably benign Het
Other mutations in Thsd7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Thsd7a APN 6 12379659 splice site probably null
IGL00563:Thsd7a APN 6 12379659 splice site probably null
IGL00753:Thsd7a APN 6 12327529 missense probably damaging 1.00
IGL00835:Thsd7a APN 6 12554934 missense probably damaging 1.00
IGL01486:Thsd7a APN 6 12471080 missense probably damaging 1.00
IGL01730:Thsd7a APN 6 12554981 missense probably benign 0.05
IGL01931:Thsd7a APN 6 12504099 missense probably damaging 1.00
IGL01935:Thsd7a APN 6 12317419 missense probably damaging 1.00
IGL01978:Thsd7a APN 6 12331006 missense probably benign 0.01
IGL02233:Thsd7a APN 6 12555258 missense probably benign 0.00
IGL02354:Thsd7a APN 6 12348193 splice site probably benign
IGL02361:Thsd7a APN 6 12348193 splice site probably benign
IGL02375:Thsd7a APN 6 12343265 missense probably damaging 1.00
IGL02468:Thsd7a APN 6 12318171 missense probably damaging 0.98
IGL02616:Thsd7a APN 6 12408985 missense probably damaging 0.98
IGL02820:Thsd7a APN 6 12321072 missense probably damaging 1.00
IGL02858:Thsd7a APN 6 12500995 missense probably benign 0.16
IGL03074:Thsd7a APN 6 12324681 missense probably damaging 0.99
IGL03234:Thsd7a APN 6 12343178 missense probably damaging 1.00
IGL03244:Thsd7a APN 6 12504168 splice site probably benign
IGL03337:Thsd7a APN 6 12405174 missense probably damaging 1.00
PIT4354001:Thsd7a UTSW 6 12331927 critical splice donor site probably null
R0095:Thsd7a UTSW 6 12320970 missense probably damaging 0.99
R0127:Thsd7a UTSW 6 12554908 missense probably benign 0.01
R0226:Thsd7a UTSW 6 12321900 missense possibly damaging 0.94
R0242:Thsd7a UTSW 6 12503916 missense probably benign 0.32
R0242:Thsd7a UTSW 6 12503916 missense probably benign 0.32
R0359:Thsd7a UTSW 6 12352031 missense probably damaging 1.00
R0365:Thsd7a UTSW 6 12321887 critical splice donor site probably null
R0504:Thsd7a UTSW 6 12379594 missense probably damaging 0.99
R0512:Thsd7a UTSW 6 12379605 missense possibly damaging 0.67
R0540:Thsd7a UTSW 6 12331542 splice site probably null
R0577:Thsd7a UTSW 6 12321048 missense possibly damaging 0.50
R0607:Thsd7a UTSW 6 12331542 splice site probably null
R0755:Thsd7a UTSW 6 12555369 missense probably damaging 1.00
R0771:Thsd7a UTSW 6 12327577 missense probably benign 0.09
R0780:Thsd7a UTSW 6 12337274 missense probably damaging 1.00
R0870:Thsd7a UTSW 6 12337274 missense probably damaging 1.00
R0871:Thsd7a UTSW 6 12337274 missense probably damaging 1.00
R0872:Thsd7a UTSW 6 12337274 missense probably damaging 1.00
R0873:Thsd7a UTSW 6 12337274 missense probably damaging 1.00
R1102:Thsd7a UTSW 6 12555702 missense possibly damaging 0.58
R1144:Thsd7a UTSW 6 12471027 splice site probably benign
R1265:Thsd7a UTSW 6 12317419 missense probably damaging 0.99
R1276:Thsd7a UTSW 6 12418370 missense probably damaging 1.00
R1381:Thsd7a UTSW 6 12555439 missense probably damaging 1.00
R1473:Thsd7a UTSW 6 12338622 missense probably benign 0.08
R1519:Thsd7a UTSW 6 12471175 missense probably benign 0.01
R1633:Thsd7a UTSW 6 12471104 nonsense probably null
R1659:Thsd7a UTSW 6 12504064 missense possibly damaging 0.73
R1769:Thsd7a UTSW 6 12555715 nonsense probably null
R1824:Thsd7a UTSW 6 12409042 splice site probably null
R1840:Thsd7a UTSW 6 12330974 missense probably benign 0.03
R1845:Thsd7a UTSW 6 12321041 missense probably damaging 1.00
R1874:Thsd7a UTSW 6 12555435 missense possibly damaging 0.76
R2023:Thsd7a UTSW 6 12327536 missense probably benign 0.16
R2039:Thsd7a UTSW 6 12408923 missense possibly damaging 0.77
R2058:Thsd7a UTSW 6 12318106 splice site probably benign
R2138:Thsd7a UTSW 6 12471073 nonsense probably null
R2155:Thsd7a UTSW 6 12379633 missense probably damaging 1.00
R2175:Thsd7a UTSW 6 12331944 missense possibly damaging 0.95
R2216:Thsd7a UTSW 6 12337268 missense possibly damaging 0.95
R2318:Thsd7a UTSW 6 12405147 missense probably damaging 1.00
R2375:Thsd7a UTSW 6 12337362 missense probably damaging 1.00
R3857:Thsd7a UTSW 6 12555226 missense probably benign 0.15
R3858:Thsd7a UTSW 6 12555226 missense probably benign 0.15
R3890:Thsd7a UTSW 6 12418337 missense probably benign 0.09
R3910:Thsd7a UTSW 6 12331549 missense probably damaging 0.96
R3933:Thsd7a UTSW 6 12555226 missense probably benign 0.15
R4369:Thsd7a UTSW 6 12468908 missense probably damaging 1.00
R4447:Thsd7a UTSW 6 12324635 missense probably damaging 0.98
R4664:Thsd7a UTSW 6 12337314 missense possibly damaging 0.79
R4664:Thsd7a UTSW 6 12504013 missense possibly damaging 0.90
R4665:Thsd7a UTSW 6 12337314 missense possibly damaging 0.79
R4665:Thsd7a UTSW 6 12504013 missense possibly damaging 0.90
R4666:Thsd7a UTSW 6 12337314 missense possibly damaging 0.79
R4666:Thsd7a UTSW 6 12504013 missense possibly damaging 0.90
R4668:Thsd7a UTSW 6 12408968 missense probably damaging 0.98
R4886:Thsd7a UTSW 6 12327660 nonsense probably null
R4918:Thsd7a UTSW 6 12327559 missense probably damaging 1.00
R4938:Thsd7a UTSW 6 12330992 missense probably benign 0.09
R5064:Thsd7a UTSW 6 12330952 missense possibly damaging 0.66
R5153:Thsd7a UTSW 6 12338655 missense probably benign 0.00
R5177:Thsd7a UTSW 6 12379583 nonsense probably null
R5242:Thsd7a UTSW 6 12327583 missense probably damaging 1.00
R5267:Thsd7a UTSW 6 12379602 missense probably damaging 1.00
R5442:Thsd7a UTSW 6 12748800 missense probably benign 0.00
R5506:Thsd7a UTSW 6 12332017 missense possibly damaging 0.85
R5525:Thsd7a UTSW 6 12332007 missense possibly damaging 0.52
R5544:Thsd7a UTSW 6 12379471 missense possibly damaging 0.94
R5651:Thsd7a UTSW 6 12343213 missense probably damaging 1.00
R5716:Thsd7a UTSW 6 12343148 missense probably benign 0.00
R5848:Thsd7a UTSW 6 12503923 missense probably damaging 1.00
R5958:Thsd7a UTSW 6 12337262 missense probably benign 0.02
R6012:Thsd7a UTSW 6 12379389 splice site probably null
R6139:Thsd7a UTSW 6 12379573 missense possibly damaging 0.93
R6243:Thsd7a UTSW 6 12327602 missense probably damaging 1.00
R6257:Thsd7a UTSW 6 12408988 nonsense probably null
R6273:Thsd7a UTSW 6 12408836 missense probably damaging 0.99
R6300:Thsd7a UTSW 6 12471104 nonsense probably null
R6314:Thsd7a UTSW 6 12554997 missense possibly damaging 0.87
R6392:Thsd7a UTSW 6 12468929 missense probably damaging 0.99
R6418:Thsd7a UTSW 6 12555082 nonsense probably null
R6515:Thsd7a UTSW 6 12501086 missense possibly damaging 0.47
R6725:Thsd7a UTSW 6 12555631 missense possibly damaging 0.87
R6742:Thsd7a UTSW 6 12408816 missense probably damaging 1.00
R6776:Thsd7a UTSW 6 12555637 missense possibly damaging 0.53
R6838:Thsd7a UTSW 6 12504075 missense probably damaging 0.99
R7104:Thsd7a UTSW 6 12379430 missense
R7170:Thsd7a UTSW 6 12352091 missense
R7349:Thsd7a UTSW 6 12352068 missense
R7460:Thsd7a UTSW 6 12554934 missense
R7467:Thsd7a UTSW 6 12331585 missense
R7666:Thsd7a UTSW 6 12379438 missense
Predicted Primers PCR Primer
(F):5'- TCACTGCTGGATTTCTGACAACCC -3'
(R):5'- ACACAACTTCTCTGGCTGACTCAAAAG -3'

Sequencing Primer
(F):5'- TGGATTTCTGACAACCCATTTTC -3'
(R):5'- AGTCTGATTTTACTGGACACCTG -3'
Posted On2013-04-16