Incidental Mutation 'R1575:St7'
ID 171087
Institutional Source Beutler Lab
Gene Symbol St7
Ensembl Gene ENSMUSG00000029534
Gene Name suppression of tumorigenicity 7
Synonyms RAY1, SEN4, Fam4a2, TSG7, 9430001H04Rik, HELG
MMRRC Submission 039613-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.151) question?
Stock # R1575 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 17692933-17943025 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 17886111 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 357 (K357N)
Ref Sequence ENSEMBL: ENSMUSP00000111079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000674] [ENSMUST00000052113] [ENSMUST00000053148] [ENSMUST00000077080] [ENSMUST00000081635] [ENSMUST00000115417] [ENSMUST00000115418] [ENSMUST00000115419] [ENSMUST00000115420] [ENSMUST00000144488] [ENSMUST00000150281]
AlphaFold Q99M96
Predicted Effect probably damaging
Transcript: ENSMUST00000000674
AA Change: K288N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000000674
Gene: ENSMUSG00000029534
AA Change: K288N

DomainStartEndE-ValueType
Pfam:ST7 2 507 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000052113
AA Change: K334N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000062886
Gene: ENSMUSG00000029534
AA Change: K334N

DomainStartEndE-ValueType
Pfam:ST7 16 554 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000053148
AA Change: K314N

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000057326
Gene: ENSMUSG00000029534
AA Change: K314N

DomainStartEndE-ValueType
Pfam:ST7 3 534 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000077080
AA Change: K311N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000076334
Gene: ENSMUSG00000029534
AA Change: K311N

DomainStartEndE-ValueType
Pfam:ST7 2 531 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000081635
AA Change: K357N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000080341
Gene: ENSMUSG00000029534
AA Change: K357N

DomainStartEndE-ValueType
Pfam:ST7 17 576 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115417
AA Change: K291N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000111077
Gene: ENSMUSG00000029534
AA Change: K291N

DomainStartEndE-ValueType
Pfam:ST7 3 511 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115418
AA Change: K334N

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111078
Gene: ENSMUSG00000029534
AA Change: K334N

DomainStartEndE-ValueType
Pfam:ST7 16 480 5e-278 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115419
AA Change: K357N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000111079
Gene: ENSMUSG00000029534
AA Change: K357N

DomainStartEndE-ValueType
Pfam:ST7 16 572 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115420
AA Change: K334N

PolyPhen 2 Score 0.601 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000111080
Gene: ENSMUSG00000029534
AA Change: K334N

DomainStartEndE-ValueType
Pfam:ST7 16 448 2.5e-278 PFAM
Pfam:ST7 445 523 2e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140358
Predicted Effect probably benign
Transcript: ENSMUST00000144488
SMART Domains Protein: ENSMUSP00000115215
Gene: ENSMUSG00000029534

DomainStartEndE-ValueType
Pfam:ST7 16 82 6.3e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154059
Predicted Effect probably benign
Transcript: ENSMUST00000150281
SMART Domains Protein: ENSMUSP00000116304
Gene: ENSMUSG00000029534

DomainStartEndE-ValueType
Pfam:ST7 16 58 1.9e-15 PFAM
Meta Mutation Damage Score 0.6628 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene for this product maps to a region on chromosome 7 identified as an autism-susceptibility locus. Mutation screening of the entire coding region in autistic individuals failed to identify phenotype-specific variants, suggesting that coding mutations for this gene are unlikely to be involved in the etiology of autism. The function of this gene product has not been determined. Transcript variants encoding different isoforms of this protein have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T A 3: 148,852,762 (GRCm38) T437S probably benign Het
Akna A G 4: 63,379,333 (GRCm38) F828S probably benign Het
Alg9 G T 9: 50,775,502 (GRCm38) A40S possibly damaging Het
Alox8 T A 11: 69,185,241 (GRCm38) H628L possibly damaging Het
Aox3 T C 1: 58,152,554 (GRCm38) W422R probably benign Het
Atp13a4 T C 16: 29,409,710 (GRCm38) D984G probably benign Het
Bcam T C 7: 19,760,382 (GRCm38) E363G possibly damaging Het
Cadps2 C A 6: 23,429,218 (GRCm38) V519F probably damaging Het
Calca A G 7: 114,635,161 (GRCm38) Y18H probably damaging Het
Cd70 A G 17: 57,146,364 (GRCm38) I100T probably damaging Het
Cdk4 T A 10: 127,064,651 (GRCm38) H95Q probably damaging Het
Chchd1 T A 14: 20,703,342 (GRCm38) N11K probably damaging Het
Cma2 T A 14: 55,972,815 (GRCm38) N52K probably damaging Het
Cyp3a16 A G 5: 145,436,457 (GRCm38) V500A probably benign Het
Dicer1 A G 12: 104,721,969 (GRCm38) probably null Het
Dnajc13 A G 9: 104,156,838 (GRCm38) S2206P probably benign Het
Dtl T C 1: 191,561,546 (GRCm38) probably null Het
Fam186b T C 15: 99,286,971 (GRCm38) T24A probably benign Het
Fbxw21 A G 9: 109,161,916 (GRCm38) V25A probably benign Het
Gins1 T C 2: 150,912,838 (GRCm38) S45P probably benign Het
Gtpbp2 T A 17: 46,165,943 (GRCm38) V349D probably damaging Het
Hyal5 G T 6: 24,876,793 (GRCm38) D222Y probably damaging Het
Itgal A G 7: 127,300,888 (GRCm38) probably null Het
Klk14 A G 7: 43,693,953 (GRCm38) probably null Het
Lama1 T A 17: 67,810,409 (GRCm38) L2518Q possibly damaging Het
Lrrc2 G A 9: 110,979,487 (GRCm38) G264D probably benign Het
Ltbp4 A G 7: 27,322,820 (GRCm38) S893P probably damaging Het
Mast4 G A 13: 102,739,263 (GRCm38) P1107L probably damaging Het
Mbd1 T A 18: 74,275,419 (GRCm38) probably null Het
Naip2 A T 13: 100,155,021 (GRCm38) D1136E probably benign Het
Naip2 G A 13: 100,155,029 (GRCm38) probably benign Het
Ncan G A 8: 70,110,198 (GRCm38) T470I probably benign Het
Npy1r A T 8: 66,704,161 (GRCm38) I78F probably damaging Het
Or10q1b A T 19: 13,705,525 (GRCm38) M233L probably benign Het
Or8b52 G A 9: 38,665,277 (GRCm38) T189M probably damaging Het
Palb2 A T 7: 122,110,838 (GRCm38) probably null Het
Pax3 T C 1: 78,103,484 (GRCm38) T422A probably benign Het
Pebp1 A T 5: 117,286,164 (GRCm38) D72E possibly damaging Het
Pnliprp1 A T 19: 58,740,469 (GRCm38) T363S probably benign Het
Rbm44 G A 1: 91,156,843 (GRCm38) probably null Het
Rbm47 T A 5: 66,025,015 (GRCm38) Y425F probably benign Het
Robo3 G T 9: 37,429,661 (GRCm38) A83E probably damaging Het
Rrm1 A G 7: 102,456,514 (GRCm38) Y279C probably damaging Het
Rslcan18 A T 13: 67,108,057 (GRCm38) probably benign Het
Scara5 C A 14: 65,730,865 (GRCm38) Q196K probably benign Het
Setd1b C T 5: 123,163,147 (GRCm38) probably benign Het
Siah1a A G 8: 86,725,241 (GRCm38) F205S probably damaging Het
Smr2 AT ATT 5: 88,108,824 (GRCm38) probably null Het
Ssu72 A G 4: 155,731,357 (GRCm38) D86G probably benign Het
Sv2b G A 7: 75,147,677 (GRCm38) T323I probably damaging Het
Syt1 T C 10: 108,504,500 (GRCm38) N319S probably benign Het
Tanc1 T A 2: 59,791,651 (GRCm38) F371L probably damaging Het
Tcf20 C A 15: 82,855,492 (GRCm38) G586V probably benign Het
Tg T C 15: 66,729,685 (GRCm38) probably null Het
Tyk2 A T 9: 21,115,462 (GRCm38) N620K probably benign Het
Ube2j1 T A 4: 33,045,116 (GRCm38) S130T probably benign Het
Ubr2 G T 17: 46,932,492 (GRCm38) P1696H probably damaging Het
Ubr5 A T 15: 38,040,841 (GRCm38) D266E probably damaging Het
Vipr2 A G 12: 116,144,272 (GRCm38) T426A probably benign Het
Vmn2r104 A T 17: 20,042,215 (GRCm38) W218R probably damaging Het
Vmn2r83 T A 10: 79,479,122 (GRCm38) N401K probably damaging Het
Vwf T A 6: 125,663,571 (GRCm38) Y2323* probably null Het
Vwf A G 6: 125,655,251 (GRCm38) E82G unknown Het
Wdr76 T G 2: 121,528,921 (GRCm38) V329G probably damaging Het
Zan A G 5: 137,461,952 (GRCm38) C1226R unknown Het
Zbtb16 G T 9: 48,832,272 (GRCm38) Q247K probably damaging Het
Zfp541 T C 7: 16,078,715 (GRCm38) V431A possibly damaging Het
Other mutations in St7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:St7 APN 6 17,855,006 (GRCm38) missense probably damaging 1.00
IGL01312:St7 APN 6 17,922,014 (GRCm38) missense probably damaging 1.00
IGL01562:St7 APN 6 17,922,035 (GRCm38) missense probably damaging 0.99
IGL01935:St7 APN 6 17,930,823 (GRCm38) missense probably damaging 0.99
IGL02127:St7 APN 6 17,844,969 (GRCm38) intron probably benign
IGL02954:St7 APN 6 17,848,031 (GRCm38) missense probably damaging 1.00
IGL02980:St7 UTSW 6 17,749,546 (GRCm38) intron probably benign
R0457:St7 UTSW 6 17,819,282 (GRCm38) missense probably damaging 1.00
R0666:St7 UTSW 6 17,934,239 (GRCm38) missense probably damaging 1.00
R0680:St7 UTSW 6 17,942,733 (GRCm38) missense probably damaging 0.99
R2039:St7 UTSW 6 17,886,112 (GRCm38) missense probably damaging 1.00
R2144:St7 UTSW 6 17,886,007 (GRCm38) missense possibly damaging 0.58
R2194:St7 UTSW 6 17,942,719 (GRCm38) missense probably damaging 1.00
R2869:St7 UTSW 6 17,819,277 (GRCm38) missense probably damaging 1.00
R2869:St7 UTSW 6 17,819,277 (GRCm38) missense probably damaging 1.00
R2873:St7 UTSW 6 17,819,277 (GRCm38) missense probably damaging 1.00
R2874:St7 UTSW 6 17,819,277 (GRCm38) missense probably damaging 1.00
R2970:St7 UTSW 6 17,844,909 (GRCm38) missense probably damaging 1.00
R3076:St7 UTSW 6 17,846,238 (GRCm38) nonsense probably null
R3921:St7 UTSW 6 17,846,245 (GRCm38) missense probably benign 0.31
R4326:St7 UTSW 6 17,819,288 (GRCm38) missense probably damaging 1.00
R4327:St7 UTSW 6 17,819,288 (GRCm38) missense probably damaging 1.00
R4410:St7 UTSW 6 17,854,933 (GRCm38) nonsense probably null
R4732:St7 UTSW 6 17,906,516 (GRCm38) splice site probably null
R4733:St7 UTSW 6 17,906,516 (GRCm38) splice site probably null
R4868:St7 UTSW 6 17,819,266 (GRCm38) missense probably damaging 1.00
R4988:St7 UTSW 6 17,934,226 (GRCm38) missense probably damaging 0.99
R5132:St7 UTSW 6 17,854,957 (GRCm38) missense probably damaging 0.97
R5182:St7 UTSW 6 17,846,237 (GRCm38) missense probably damaging 0.99
R5195:St7 UTSW 6 17,743,637 (GRCm38) intron probably benign
R5358:St7 UTSW 6 17,819,318 (GRCm38) missense probably damaging 1.00
R5502:St7 UTSW 6 17,834,674 (GRCm38) missense possibly damaging 0.94
R5882:St7 UTSW 6 17,846,249 (GRCm38) missense probably damaging 1.00
R5976:St7 UTSW 6 17,694,222 (GRCm38) missense possibly damaging 0.93
R6049:St7 UTSW 6 17,694,348 (GRCm38) missense possibly damaging 0.92
R6139:St7 UTSW 6 17,694,354 (GRCm38) missense probably damaging 1.00
R6177:St7 UTSW 6 17,819,334 (GRCm38) critical splice donor site probably null
R6181:St7 UTSW 6 17,694,364 (GRCm38) critical splice donor site probably null
R6401:St7 UTSW 6 17,855,318 (GRCm38) splice site probably null
R6546:St7 UTSW 6 17,852,314 (GRCm38) missense probably damaging 1.00
R6711:St7 UTSW 6 17,848,070 (GRCm38) missense possibly damaging 0.82
R6898:St7 UTSW 6 17,854,946 (GRCm38) missense probably damaging 1.00
R7536:St7 UTSW 6 17,886,020 (GRCm38) missense probably damaging 0.99
R7583:St7 UTSW 6 17,942,754 (GRCm38) missense possibly damaging 0.54
R7626:St7 UTSW 6 17,934,217 (GRCm38) missense probably damaging 1.00
R7718:St7 UTSW 6 17,854,999 (GRCm38) missense probably damaging 0.99
R7943:St7 UTSW 6 17,844,912 (GRCm38) missense probably damaging 1.00
R8334:St7 UTSW 6 17,934,221 (GRCm38) missense probably damaging 1.00
R8415:St7 UTSW 6 17,848,081 (GRCm38) critical splice donor site probably null
R9018:St7 UTSW 6 17,906,495 (GRCm38) missense probably damaging 1.00
R9217:St7 UTSW 6 17,846,272 (GRCm38) missense probably damaging 0.98
R9294:St7 UTSW 6 17,844,914 (GRCm38) nonsense probably null
Z1176:St7 UTSW 6 17,848,045 (GRCm38) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAGGCCAGACATCAGTTTCTGGTA -3'
(R):5'- GCTGGAGAGTAACCATCGGAACACT -3'

Sequencing Primer
(F):5'- tcctttccttccctttttcttttg -3'
(R):5'- TCGGAACACTACGGGTGATAATTC -3'
Posted On 2014-04-13