Incidental Mutation 'R4410:St7'
ID 374403
Institutional Source Beutler Lab
Gene Symbol St7
Ensembl Gene ENSMUSG00000029534
Gene Name suppression of tumorigenicity 7
Synonyms RAY1, HELG, TSG7, Fam4a2, 9430001H04Rik, SEN4
MMRRC Submission 041692-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.147) question?
Stock # R4410 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 17693579-17943022 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 17854932 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 267 (R267*)
Ref Sequence ENSEMBL: ENSMUSP00000111080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000674] [ENSMUST00000052113] [ENSMUST00000053148] [ENSMUST00000077080] [ENSMUST00000081635] [ENSMUST00000115417] [ENSMUST00000115418] [ENSMUST00000115419] [ENSMUST00000115420] [ENSMUST00000125673] [ENSMUST00000144488] [ENSMUST00000150281]
AlphaFold Q99M96
Predicted Effect probably null
Transcript: ENSMUST00000000674
AA Change: R221*
SMART Domains Protein: ENSMUSP00000000674
Gene: ENSMUSG00000029534
AA Change: R221*

DomainStartEndE-ValueType
Pfam:ST7 2 507 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000052113
AA Change: R267*
SMART Domains Protein: ENSMUSP00000062886
Gene: ENSMUSG00000029534
AA Change: R267*

DomainStartEndE-ValueType
Pfam:ST7 16 554 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000053148
AA Change: R247*
SMART Domains Protein: ENSMUSP00000057326
Gene: ENSMUSG00000029534
AA Change: R247*

DomainStartEndE-ValueType
Pfam:ST7 3 534 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000077080
AA Change: R244*
SMART Domains Protein: ENSMUSP00000076334
Gene: ENSMUSG00000029534
AA Change: R244*

DomainStartEndE-ValueType
Pfam:ST7 2 531 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000081635
AA Change: R290*
SMART Domains Protein: ENSMUSP00000080341
Gene: ENSMUSG00000029534
AA Change: R290*

DomainStartEndE-ValueType
Pfam:ST7 17 576 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115417
AA Change: R224*
SMART Domains Protein: ENSMUSP00000111077
Gene: ENSMUSG00000029534
AA Change: R224*

DomainStartEndE-ValueType
Pfam:ST7 3 511 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115418
AA Change: R267*
SMART Domains Protein: ENSMUSP00000111078
Gene: ENSMUSG00000029534
AA Change: R267*

DomainStartEndE-ValueType
Pfam:ST7 16 480 5e-278 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115419
AA Change: R290*
SMART Domains Protein: ENSMUSP00000111079
Gene: ENSMUSG00000029534
AA Change: R290*

DomainStartEndE-ValueType
Pfam:ST7 16 572 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115420
AA Change: R267*
SMART Domains Protein: ENSMUSP00000111080
Gene: ENSMUSG00000029534
AA Change: R267*

DomainStartEndE-ValueType
Pfam:ST7 16 448 2.5e-278 PFAM
Pfam:ST7 445 523 2e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127181
AA Change: T273M
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144021
AA Change: T296M
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154059
Predicted Effect probably benign
Transcript: ENSMUST00000125673
SMART Domains Protein: ENSMUSP00000122970
Gene: ENSMUSG00000029534

DomainStartEndE-ValueType
Pfam:ST7 16 52 1.9e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144488
SMART Domains Protein: ENSMUSP00000115215
Gene: ENSMUSG00000029534

DomainStartEndE-ValueType
Pfam:ST7 16 82 6.3e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140358
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144743
Predicted Effect probably benign
Transcript: ENSMUST00000150281
SMART Domains Protein: ENSMUSP00000116304
Gene: ENSMUSG00000029534

DomainStartEndE-ValueType
Pfam:ST7 16 58 1.9e-15 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene for this product maps to a region on chromosome 7 identified as an autism-susceptibility locus. Mutation screening of the entire coding region in autistic individuals failed to identify phenotype-specific variants, suggesting that coding mutations for this gene are unlikely to be involved in the etiology of autism. The function of this gene product has not been determined. Transcript variants encoding different isoforms of this protein have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap39 A T 15: 76,609,712 (GRCm39) probably benign Het
Arrb1 G T 7: 99,247,503 (GRCm39) probably benign Het
Cadps A G 14: 12,822,323 (GRCm38) M139T probably damaging Het
Casr A G 16: 36,320,703 (GRCm39) C482R probably benign Het
Cdca4 A T 12: 112,785,499 (GRCm39) H76Q probably benign Het
Ddias A G 7: 92,507,287 (GRCm39) L876P probably benign Het
Dnah9 T C 11: 65,976,303 (GRCm39) S1249G possibly damaging Het
Dnttip1 A G 2: 164,609,739 (GRCm39) probably benign Het
Eme2 A G 17: 25,112,598 (GRCm39) S160P probably benign Het
Fbxw24 A T 9: 109,437,256 (GRCm39) D210E probably damaging Het
Folr2 T C 7: 101,489,881 (GRCm39) E129G probably damaging Het
Herc6 T A 6: 57,636,664 (GRCm39) N793K possibly damaging Het
Iqcg T G 16: 32,851,186 (GRCm39) K262Q possibly damaging Het
Lhfpl3 A G 5: 22,980,690 (GRCm39) probably benign Het
Lmod2 A C 6: 24,604,629 (GRCm39) S535R probably damaging Het
Lrp1b T A 2: 40,555,094 (GRCm39) S342C possibly damaging Het
Lrrn3 T A 12: 41,502,583 (GRCm39) Y578F possibly damaging Het
Map3k4 T A 17: 12,467,885 (GRCm39) R1050W probably damaging Het
Muc6 T A 7: 141,217,576 (GRCm39) T2301S possibly damaging Het
Mycbp2 T C 14: 103,372,702 (GRCm39) E4048G probably damaging Het
Myh3 G C 11: 66,975,858 (GRCm39) E297Q possibly damaging Het
Nkain3 A G 4: 20,778,284 (GRCm39) V11A probably benign Het
Or4c102 G A 2: 88,422,765 (GRCm39) V206I probably benign Het
P3h2 G C 16: 25,924,040 (GRCm39) R132G possibly damaging Het
Pals2 C T 6: 50,175,248 (GRCm39) Q520* probably null Het
Phgdh A G 3: 98,221,591 (GRCm39) M447T probably benign Het
Pmfbp1 G A 8: 110,258,695 (GRCm39) A667T probably benign Het
Pramel41 A T 5: 94,593,720 (GRCm39) Q15L probably benign Het
Psmd2 T G 16: 20,473,776 (GRCm39) C230G probably damaging Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Slc37a3 T A 6: 39,315,747 (GRCm39) Y443F probably benign Het
Sorl1 C A 9: 41,915,288 (GRCm39) G1314* probably null Het
Spag7 T C 11: 70,555,688 (GRCm39) D83G probably damaging Het
Syne2 C T 12: 76,141,167 (GRCm39) S99L probably damaging Het
Tacc2 T G 7: 130,343,941 (GRCm39) S2533R possibly damaging Het
Tmem59l A G 8: 70,939,951 (GRCm39) L6S unknown Het
Uaca T G 9: 60,777,173 (GRCm39) V518G probably damaging Het
Usp43 T C 11: 67,746,716 (GRCm39) E992G probably benign Het
Vmn1r55 A G 7: 5,150,075 (GRCm39) V116A probably benign Het
Wdr3 G A 3: 100,047,543 (GRCm39) T844M probably benign Het
Wdr7 T A 18: 63,911,320 (GRCm39) M904K probably damaging Het
Zbtb39 A G 10: 127,578,696 (GRCm39) I423M possibly damaging Het
Zmym1 A T 4: 126,941,897 (GRCm39) C830* probably null Het
Other mutations in St7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:St7 APN 6 17,855,005 (GRCm39) missense probably damaging 1.00
IGL01312:St7 APN 6 17,922,013 (GRCm39) missense probably damaging 1.00
IGL01562:St7 APN 6 17,922,034 (GRCm39) missense probably damaging 0.99
IGL01935:St7 APN 6 17,930,822 (GRCm39) missense probably damaging 0.99
IGL02127:St7 APN 6 17,844,968 (GRCm39) intron probably benign
IGL02954:St7 APN 6 17,848,030 (GRCm39) missense probably damaging 1.00
IGL02980:St7 UTSW 6 17,749,545 (GRCm39) intron probably benign
R0457:St7 UTSW 6 17,819,281 (GRCm39) missense probably damaging 1.00
R0666:St7 UTSW 6 17,934,238 (GRCm39) missense probably damaging 1.00
R0680:St7 UTSW 6 17,942,732 (GRCm39) missense probably damaging 0.99
R1575:St7 UTSW 6 17,886,110 (GRCm39) missense probably damaging 1.00
R2039:St7 UTSW 6 17,886,111 (GRCm39) missense probably damaging 1.00
R2144:St7 UTSW 6 17,886,006 (GRCm39) missense possibly damaging 0.58
R2194:St7 UTSW 6 17,942,718 (GRCm39) missense probably damaging 1.00
R2869:St7 UTSW 6 17,819,276 (GRCm39) missense probably damaging 1.00
R2869:St7 UTSW 6 17,819,276 (GRCm39) missense probably damaging 1.00
R2873:St7 UTSW 6 17,819,276 (GRCm39) missense probably damaging 1.00
R2874:St7 UTSW 6 17,819,276 (GRCm39) missense probably damaging 1.00
R2970:St7 UTSW 6 17,844,908 (GRCm39) missense probably damaging 1.00
R3076:St7 UTSW 6 17,846,237 (GRCm39) nonsense probably null
R3921:St7 UTSW 6 17,846,244 (GRCm39) missense probably benign 0.31
R4326:St7 UTSW 6 17,819,287 (GRCm39) missense probably damaging 1.00
R4327:St7 UTSW 6 17,819,287 (GRCm39) missense probably damaging 1.00
R4732:St7 UTSW 6 17,906,515 (GRCm39) splice site probably null
R4733:St7 UTSW 6 17,906,515 (GRCm39) splice site probably null
R4868:St7 UTSW 6 17,819,265 (GRCm39) missense probably damaging 1.00
R4988:St7 UTSW 6 17,934,225 (GRCm39) missense probably damaging 0.99
R5132:St7 UTSW 6 17,854,956 (GRCm39) missense probably damaging 0.97
R5182:St7 UTSW 6 17,846,236 (GRCm39) missense probably damaging 0.99
R5195:St7 UTSW 6 17,743,636 (GRCm39) intron probably benign
R5358:St7 UTSW 6 17,819,317 (GRCm39) missense probably damaging 1.00
R5502:St7 UTSW 6 17,834,673 (GRCm39) missense possibly damaging 0.94
R5882:St7 UTSW 6 17,846,248 (GRCm39) missense probably damaging 1.00
R5976:St7 UTSW 6 17,694,221 (GRCm39) missense possibly damaging 0.93
R6049:St7 UTSW 6 17,694,347 (GRCm39) missense possibly damaging 0.92
R6139:St7 UTSW 6 17,694,353 (GRCm39) missense probably damaging 1.00
R6177:St7 UTSW 6 17,819,333 (GRCm39) critical splice donor site probably null
R6181:St7 UTSW 6 17,694,363 (GRCm39) critical splice donor site probably null
R6401:St7 UTSW 6 17,855,317 (GRCm39) splice site probably null
R6546:St7 UTSW 6 17,852,313 (GRCm39) missense probably damaging 1.00
R6711:St7 UTSW 6 17,848,069 (GRCm39) missense possibly damaging 0.82
R6898:St7 UTSW 6 17,854,945 (GRCm39) missense probably damaging 1.00
R7536:St7 UTSW 6 17,886,019 (GRCm39) missense probably damaging 0.99
R7583:St7 UTSW 6 17,942,753 (GRCm39) missense possibly damaging 0.54
R7626:St7 UTSW 6 17,934,216 (GRCm39) missense probably damaging 1.00
R7718:St7 UTSW 6 17,854,998 (GRCm39) missense probably damaging 0.99
R7943:St7 UTSW 6 17,844,911 (GRCm39) missense probably damaging 1.00
R8334:St7 UTSW 6 17,934,220 (GRCm39) missense probably damaging 1.00
R8415:St7 UTSW 6 17,848,080 (GRCm39) critical splice donor site probably null
R9018:St7 UTSW 6 17,906,494 (GRCm39) missense probably damaging 1.00
R9217:St7 UTSW 6 17,846,271 (GRCm39) missense probably damaging 0.98
R9294:St7 UTSW 6 17,844,913 (GRCm39) nonsense probably null
Z1176:St7 UTSW 6 17,848,044 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTAGCACAAATGAGCCTCTGC -3'
(R):5'- ACTATGGTATTATCATGGCTCAGC -3'

Sequencing Primer
(F):5'- AGTTTGCAAGTCCAATGGGCC -3'
(R):5'- CCTTCGAGGCCCATTTGC -3'
Posted On 2016-03-09