Incidental Mutation 'R2078:Tmem63b'
ID229304
Institutional Source Beutler Lab
Gene Symbol Tmem63b
Ensembl Gene ENSMUSG00000036026
Gene Nametransmembrane protein 63b
Synonyms
MMRRC Submission 040083-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2078 (G1)
Quality Score190
Status Not validated
Chromosome17
Chromosomal Location45660171-45686905 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45663536 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 603 (S603P)
Ref Sequence ENSEMBL: ENSMUSP00000109151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113523] [ENSMUST00000120717] [ENSMUST00000145873] [ENSMUST00000151350]
Predicted Effect possibly damaging
Transcript: ENSMUST00000113523
AA Change: S603P

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109151
Gene: ENSMUSG00000036026
AA Change: S603P

DomainStartEndE-ValueType
transmembrane domain 40 62 N/A INTRINSIC
low complexity region 82 92 N/A INTRINSIC
Pfam:RSN1_TM 101 226 2.5e-23 PFAM
Pfam:PHM7_cyt 274 344 9.1e-10 PFAM
Pfam:RSN1_7TM 362 706 5.3e-96 PFAM
transmembrane domain 711 733 N/A INTRINSIC
low complexity region 778 805 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120717
SMART Domains Protein: ENSMUSP00000113132
Gene: ENSMUSG00000058626

DomainStartEndE-ValueType
CysPc 37 362 2.75e-157 SMART
calpain_III 366 523 2.57e-84 SMART
EFh 590 618 3.91e-4 SMART
EFh 620 648 6.88e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129177
Predicted Effect probably benign
Transcript: ENSMUST00000145873
SMART Domains Protein: ENSMUSP00000121681
Gene: ENSMUSG00000036026

DomainStartEndE-ValueType
transmembrane domain 40 62 N/A INTRINSIC
Pfam:RSN1_TM 87 213 1.1e-24 PFAM
Blast:RRM 228 308 3e-23 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000151350
SMART Domains Protein: ENSMUSP00000119679
Gene: ENSMUSG00000058626

DomainStartEndE-ValueType
Pfam:Peptidase_C2 94 153 1.5e-14 PFAM
low complexity region 163 174 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156224
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 C A 1: 75,172,136 G55C probably damaging Het
Acss3 T C 10: 106,967,041 T448A possibly damaging Het
Atxn7 A G 14: 14,052,975 N138D probably damaging Het
Cacna2d4 A T 6: 119,338,116 D869V probably benign Het
Cps1 T G 1: 67,157,806 Y339D probably damaging Het
Cps1 T C 1: 67,195,265 I937T possibly damaging Het
Dlgap4 T C 2: 156,762,826 S261P probably damaging Het
Dusp6 T C 10: 99,263,824 Y45H probably damaging Het
Ebag9 A G 15: 44,636,804 N157S probably damaging Het
Exoc4 A G 6: 33,910,587 D770G probably benign Het
Ezr A G 17: 6,782,642 M1T probably null Het
Fat4 A G 3: 38,889,673 N905S probably damaging Het
Fcrlb C G 1: 170,908,081 R208P probably damaging Het
Flnb T C 14: 7,927,466 V1892A probably damaging Het
Gas2 G A 7: 51,897,325 V75M probably benign Het
Gda T A 19: 21,400,672 D267V probably damaging Het
Gper1 A T 5: 139,426,133 I78F probably benign Het
Hectd1 A C 12: 51,748,542 I2368S probably damaging Het
Katna1 C T 10: 7,743,569 P114S probably benign Het
Lce3c G A 3: 92,945,451 S73N unknown Het
Lrfn3 A T 7: 30,360,454 D115E possibly damaging Het
Lrrc47 C A 4: 154,019,431 T505K probably damaging Het
Mertk C T 2: 128,794,458 T784I probably damaging Het
Mettl21e T A 1: 44,206,502 I195F possibly damaging Het
Mff T C 1: 82,741,921 S207P probably damaging Het
Mtmr6 A G 14: 60,291,987 probably null Het
Myh9 T C 15: 77,763,912 K1788R probably benign Het
Narf A G 11: 121,245,394 T199A probably benign Het
Neurod6 A G 6: 55,678,969 S228P probably benign Het
Notch4 A T 17: 34,568,715 probably null Het
Nyap2 T C 1: 81,191,981 L151P probably damaging Het
Olfr1444 T A 19: 12,862,387 V204E probably benign Het
P2ry1 A G 3: 61,003,697 I86V probably damaging Het
Pafah1b2 G T 9: 45,968,829 D183E probably damaging Het
Phldb1 T C 9: 44,707,979 E179G probably damaging Het
Piezo2 T C 18: 63,117,720 E436G probably damaging Het
Pkhd1l1 A G 15: 44,527,767 I1514V probably benign Het
Plch1 A G 3: 63,701,943 S948P probably benign Het
Rfc5 A G 5: 117,380,803 V296A probably benign Het
Rnf150 A T 8: 83,003,605 I255F probably damaging Het
Rsbn1 A G 3: 103,961,523 D626G probably damaging Het
Sfswap A G 5: 129,516,107 D346G possibly damaging Het
Slc38a11 A T 2: 65,330,384 F289I possibly damaging Het
Terf2ip A G 8: 112,015,403 N243S probably benign Het
Tmed5 A T 5: 108,124,605 V209E probably damaging Het
Tomm20 T C 8: 126,937,072 M121V possibly damaging Het
Tspan33 G A 6: 29,709,971 V45I probably benign Het
Usp17la A T 7: 104,859,393 M1L probably benign Het
Vsig8 C A 1: 172,563,289 D301E probably benign Het
Vwa8 T A 14: 78,908,157 H91Q probably damaging Het
Other mutations in Tmem63b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01681:Tmem63b APN 17 45663571 missense probably damaging 1.00
IGL02486:Tmem63b APN 17 45673983 missense probably damaging 0.97
IGL02519:Tmem63b APN 17 45665208 missense possibly damaging 0.46
IGL02893:Tmem63b APN 17 45661900 missense probably damaging 1.00
IGL03137:Tmem63b APN 17 45664995 missense probably damaging 0.98
R0211:Tmem63b UTSW 17 45661913 missense probably benign 0.00
R0211:Tmem63b UTSW 17 45661913 missense probably benign 0.00
R0276:Tmem63b UTSW 17 45675373 splice site probably benign
R0441:Tmem63b UTSW 17 45666315 critical splice donor site probably null
R0729:Tmem63b UTSW 17 45674134 missense probably damaging 1.00
R0749:Tmem63b UTSW 17 45666115 missense possibly damaging 0.89
R0834:Tmem63b UTSW 17 45660944 missense possibly damaging 0.93
R0835:Tmem63b UTSW 17 45660944 missense possibly damaging 0.93
R0865:Tmem63b UTSW 17 45661519 missense probably benign 0.02
R1144:Tmem63b UTSW 17 45666427 missense probably benign 0.07
R1448:Tmem63b UTSW 17 45678978 missense possibly damaging 0.89
R1468:Tmem63b UTSW 17 45678978 missense possibly damaging 0.89
R1468:Tmem63b UTSW 17 45678978 missense possibly damaging 0.89
R1538:Tmem63b UTSW 17 45678978 missense possibly damaging 0.89
R1853:Tmem63b UTSW 17 45661297 missense possibly damaging 0.68
R1935:Tmem63b UTSW 17 45678961 critical splice donor site probably null
R2518:Tmem63b UTSW 17 45666154 missense probably benign
R3911:Tmem63b UTSW 17 45677958 missense probably damaging 1.00
R5093:Tmem63b UTSW 17 45660874 missense probably damaging 1.00
R5186:Tmem63b UTSW 17 45661477 missense possibly damaging 0.68
R5364:Tmem63b UTSW 17 45664727 unclassified probably benign
R5396:Tmem63b UTSW 17 45669962 missense possibly damaging 0.72
R5548:Tmem63b UTSW 17 45664958 missense probably damaging 0.98
R5582:Tmem63b UTSW 17 45667763 missense probably benign
R5998:Tmem63b UTSW 17 45670000 missense possibly damaging 0.94
R6198:Tmem63b UTSW 17 45661516 missense probably benign 0.00
R6656:Tmem63b UTSW 17 45667708 missense probably benign
R6808:Tmem63b UTSW 17 45660808 missense probably benign 0.13
R6967:Tmem63b UTSW 17 45666632 missense probably benign 0.00
R7089:Tmem63b UTSW 17 45667783 missense probably benign 0.00
R7181:Tmem63b UTSW 17 45673168 missense probably benign 0.00
R7214:Tmem63b UTSW 17 45661822 missense probably benign 0.02
R7267:Tmem63b UTSW 17 45666122 missense probably benign
R7323:Tmem63b UTSW 17 45660847 missense possibly damaging 0.86
R7346:Tmem63b UTSW 17 45666591 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCATCGCTATATATGTGGGAAAGC -3'
(R):5'- GTGCTGTCATGCTAGCAGTG -3'

Sequencing Primer
(F):5'- TCGCTATATATGTGGGAAAGCTGAGG -3'
(R):5'- GCAGACAGCCACCAGGTC -3'
Posted On2014-09-17