Incidental Mutation 'R2112:Ppargc1b'
ID232706
Institutional Source Beutler Lab
Gene Symbol Ppargc1b
Ensembl Gene ENSMUSG00000033871
Gene Nameperoxisome proliferative activated receptor, gamma, coactivator 1 beta
SynonymsPGC-1beta/ERRL1, 4631412G21Rik
MMRRC Submission 040116-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.441) question?
Stock #R2112 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location61298136-61400431 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 61311250 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 297 (P297S)
Ref Sequence ENSEMBL: ENSMUSP00000069431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063307] [ENSMUST00000075299]
Predicted Effect probably benign
Transcript: ENSMUST00000063307
AA Change: P297S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000069431
Gene: ENSMUSG00000033871
AA Change: P297S

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 107 112 N/A INTRINSIC
low complexity region 137 156 N/A INTRINSIC
low complexity region 169 189 N/A INTRINSIC
coiled coil region 437 472 N/A INTRINSIC
low complexity region 613 619 N/A INTRINSIC
low complexity region 640 656 N/A INTRINSIC
low complexity region 799 833 N/A INTRINSIC
low complexity region 852 872 N/A INTRINSIC
RRM 910 980 8.87e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075299
AA Change: P281S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074771
Gene: ENSMUSG00000033871
AA Change: P281S

DomainStartEndE-ValueType
low complexity region 91 96 N/A INTRINSIC
low complexity region 121 140 N/A INTRINSIC
low complexity region 153 173 N/A INTRINSIC
coiled coil region 421 456 N/A INTRINSIC
low complexity region 597 603 N/A INTRINSIC
low complexity region 624 640 N/A INTRINSIC
low complexity region 783 817 N/A INTRINSIC
low complexity region 836 856 N/A INTRINSIC
RRM 894 964 8.87e-7 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene stimulates the activity of several transcription factors and nuclear receptors, including estrogen receptor alpha, nuclear respiratory factor 1, and glucocorticoid receptor. The encoded protein may be involved in fat oxidation, non-oxidative glucose metabolism, and the regulation of energy expenditure. This protein is downregulated in prediabetic and type 2 diabetes mellitus patients. Certain allelic variations in this gene increase the risk of the development of obesity. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous inactivation of this gene can lead to postnatal lethality and impaired mitochondrial activity, adaptive thermogenesis, and hepatic function. Homozygotes for a null allele also display a defect in heart rate regulation, reduced body weight and WAT content, and increased energy expenditure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik C T 10: 3,126,459 noncoding transcript Het
Adam1b A G 5: 121,500,714 probably benign Het
Adprhl1 A G 8: 13,248,694 Y79H probably damaging Het
Ambra1 T A 2: 91,875,787 W746R probably damaging Het
Ankhd1 A T 18: 36,641,626 K1420I probably damaging Het
Ap1b1 T C 11: 5,015,613 F51L probably damaging Het
Arhgap24 A C 5: 102,892,500 R434S probably damaging Het
Arhgap29 T C 3: 122,011,561 L525P probably benign Het
Arpc1b T C 5: 145,123,769 Y124H probably damaging Het
Arr3 T A X: 100,614,641 F269L possibly damaging Het
Atp11b G T 3: 35,837,528 V830F probably damaging Het
Ccdc71l T A 12: 32,379,230 F83I probably damaging Het
Cdh23 G T 10: 60,305,583 F3127L probably damaging Het
Cldn15 T A 5: 136,968,162 M19K possibly damaging Het
Cog4 A G 8: 110,858,582 Y292C possibly damaging Het
Col12a1 A G 9: 79,643,899 V2145A possibly damaging Het
Col5a3 T C 9: 20,809,777 I110V unknown Het
Cps1 T A 1: 67,176,980 D821E probably benign Het
Crnkl1 A T 2: 145,930,697 Y153* probably null Het
Dock10 T A 1: 80,505,642 K2082M probably damaging Het
Dock10 T C 1: 80,505,643 K2083E probably damaging Het
Dst T C 1: 34,169,178 S737P probably damaging Het
Dthd1 T C 5: 62,821,908 Y304H probably damaging Het
Dthd1 T C 5: 62,842,879 S515P probably damaging Het
Etf1 A T 18: 34,909,101 probably null Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Galt A G 4: 41,758,245 T337A probably benign Het
Gbp4 A G 5: 105,135,176 L76P possibly damaging Het
Gcfc2 C A 6: 81,923,778 D24E probably benign Het
Gigyf2 A G 1: 87,440,730 H1044R probably damaging Het
Glg1 T C 8: 111,192,546 D315G probably damaging Het
Gm4787 C T 12: 81,377,833 C517Y probably damaging Het
Gnl3l A G X: 150,997,294 S217P probably damaging Het
Gpr37 T C 6: 25,669,381 Y488C possibly damaging Het
Hap1 T C 11: 100,353,999 D240G probably benign Het
Hhla1 C G 15: 65,936,383 W271S probably benign Het
Hmgxb3 T C 18: 61,155,386 R470G possibly damaging Het
Inpp5a A G 7: 139,574,961 D332G probably damaging Het
Insr A G 8: 3,169,748 S925P probably benign Het
Isoc2b T A 7: 4,849,475 D171V probably damaging Het
Kif20b T C 19: 34,931,732 I223T probably benign Het
Krt6b T C 15: 101,678,564 T258A possibly damaging Het
Lipo4 G A 19: 33,511,526 P219L probably benign Het
Luc7l T C 17: 26,255,127 probably null Het
Madd T C 2: 91,176,976 K264E possibly damaging Het
Mcf2l A T 8: 13,001,867 K433N probably damaging Het
Mob3b A T 4: 35,083,795 N131K probably damaging Het
Mtus1 G T 8: 41,022,571 P819T probably damaging Het
Myo15 T C 11: 60,494,168 F1699L probably damaging Het
Nav1 C T 1: 135,449,004 R1694Q probably damaging Het
Neb G C 2: 52,328,764 T78S probably damaging Het
Nek2 T C 1: 191,827,208 V275A probably benign Het
Nfatc1 A T 18: 80,635,664 C836* probably null Het
Nos1 T C 5: 117,936,571 V1060A probably benign Het
Notch3 T A 17: 32,144,610 I1160F probably benign Het
Nox4 T C 7: 87,372,008 L476P probably damaging Het
Npc1 A T 18: 12,213,472 N222K possibly damaging Het
Nrn1l C A 8: 105,894,746 H109Q possibly damaging Het
Olfr1206 T C 2: 88,865,201 S199P possibly damaging Het
Olfr213 T C 6: 116,540,650 Y66H possibly damaging Het
Olfr57 T C 10: 79,035,414 L206P probably damaging Het
Olfr727 G T 14: 50,126,623 L15F probably damaging Het
Olfr944 T C 9: 39,217,779 Y141H probably benign Het
Olfr952 C A 9: 39,426,670 V134L probably benign Het
Pcnt T C 10: 76,420,526 K627E probably damaging Het
Plch1 T A 3: 63,722,806 T514S probably damaging Het
Ppig A G 2: 69,750,107 T662A unknown Het
Prdm2 A C 4: 143,131,936 S1595A probably benign Het
Ptpn5 T A 7: 47,083,142 T318S probably benign Het
Ralgps2 A G 1: 156,832,708 Y265H probably damaging Het
Seh1l T C 18: 67,787,179 I182T probably damaging Het
Slc12a6 T C 2: 112,356,485 I943T probably damaging Het
Slc5a5 A T 8: 70,889,751 probably null Het
Sparcl1 T A 5: 104,088,423 Q488L probably damaging Het
Sphkap T G 1: 83,275,881 K1382N probably benign Het
Sybu T C 15: 44,673,335 S532G probably benign Het
Syde2 G A 3: 145,998,486 G131S possibly damaging Het
Taok1 C T 11: 77,571,646 V206I probably benign Het
Tas1r2 G T 4: 139,655,355 M101I probably benign Het
Trpc6 C T 9: 8,656,612 T680I probably damaging Het
Trub1 T C 19: 57,485,214 probably null Het
Tspan1 G T 4: 116,163,688 probably null Het
Ttc28 G A 5: 111,276,273 E1438K probably damaging Het
Ubr3 A G 2: 69,977,792 T1206A possibly damaging Het
Usp40 A G 1: 87,950,214 I1117T probably benign Het
Usp43 G T 11: 67,921,710 N113K probably damaging Het
Vcan T A 13: 89,693,303 D414V probably damaging Het
Vmn1r202 T A 13: 22,501,734 Y171F possibly damaging Het
Wdr66 G A 5: 123,254,375 probably benign Het
Zfp142 A G 1: 74,573,636 S451P probably damaging Het
Zfp516 A G 18: 82,957,411 D578G probably damaging Het
Zfp90 G A 8: 106,425,488 C611Y probably damaging Het
Zfp954 A G 7: 7,115,610 C312R probably damaging Het
Zmym3 A T X: 101,407,387 V1208D probably damaging Het
Other mutations in Ppargc1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Ppargc1b APN 18 61323164 missense probably damaging 1.00
IGL02160:Ppargc1b APN 18 61310435 missense probably damaging 1.00
IGL02176:Ppargc1b APN 18 61310875 nonsense probably null
IGL02176:Ppargc1b APN 18 61310874 missense probably damaging 1.00
IGL02183:Ppargc1b APN 18 61309096 critical splice acceptor site probably null
IGL02386:Ppargc1b APN 18 61323151 missense probably damaging 1.00
IGL02620:Ppargc1b APN 18 61298739 missense probably damaging 1.00
IGL02688:Ppargc1b APN 18 61312243 missense possibly damaging 0.94
IGL02801:Ppargc1b APN 18 61307684 missense possibly damaging 0.77
IGL02970:Ppargc1b APN 18 61298766 missense probably damaging 1.00
R0033:Ppargc1b UTSW 18 61307694 missense probably damaging 1.00
R0139:Ppargc1b UTSW 18 61315963 splice site probably benign
R0194:Ppargc1b UTSW 18 61307945 missense possibly damaging 0.94
R0412:Ppargc1b UTSW 18 61315861 missense probably damaging 0.99
R0574:Ppargc1b UTSW 18 61302739 missense probably benign 0.34
R0576:Ppargc1b UTSW 18 61311441 missense probably damaging 0.98
R1546:Ppargc1b UTSW 18 61310606 missense probably damaging 1.00
R1721:Ppargc1b UTSW 18 61307204 splice site probably null
R1758:Ppargc1b UTSW 18 61298786 splice site probably null
R1951:Ppargc1b UTSW 18 61298777 missense possibly damaging 0.55
R2110:Ppargc1b UTSW 18 61311250 missense probably benign 0.00
R2212:Ppargc1b UTSW 18 61311220 nonsense probably null
R2432:Ppargc1b UTSW 18 61307799 missense possibly damaging 0.93
R3612:Ppargc1b UTSW 18 61310556 missense probably benign 0.07
R3848:Ppargc1b UTSW 18 61311042 missense probably damaging 1.00
R3913:Ppargc1b UTSW 18 61311376 missense probably damaging 0.99
R4328:Ppargc1b UTSW 18 61382469 nonsense probably null
R4502:Ppargc1b UTSW 18 61302679 missense probably benign 0.39
R4762:Ppargc1b UTSW 18 61311257 missense possibly damaging 0.93
R5032:Ppargc1b UTSW 18 61307265 missense probably damaging 1.00
R5111:Ppargc1b UTSW 18 61310487 missense probably damaging 1.00
R5119:Ppargc1b UTSW 18 61307654 missense probably benign 0.38
R5164:Ppargc1b UTSW 18 61302644 missense probably damaging 1.00
R5266:Ppargc1b UTSW 18 61315805 missense probably damaging 1.00
R5350:Ppargc1b UTSW 18 61309063 missense possibly damaging 0.78
R5478:Ppargc1b UTSW 18 61307568 missense probably benign
R5719:Ppargc1b UTSW 18 61307568 missense probably benign
R5876:Ppargc1b UTSW 18 61309093 missense probably damaging 0.99
R5877:Ppargc1b UTSW 18 61309093 missense probably damaging 0.99
R5879:Ppargc1b UTSW 18 61309093 missense probably damaging 0.99
R5967:Ppargc1b UTSW 18 61298766 missense probably damaging 1.00
R6030:Ppargc1b UTSW 18 61307934 nonsense probably null
R6030:Ppargc1b UTSW 18 61307934 nonsense probably null
R6135:Ppargc1b UTSW 18 61315909 missense probably damaging 0.99
R6533:Ppargc1b UTSW 18 61307774 missense possibly damaging 0.93
R6791:Ppargc1b UTSW 18 61307676 missense probably damaging 1.00
R6792:Ppargc1b UTSW 18 61307676 missense probably damaging 1.00
R7033:Ppargc1b UTSW 18 61307714 missense probably damaging 0.96
R7316:Ppargc1b UTSW 18 61307838 missense probably damaging 0.97
R7560:Ppargc1b UTSW 18 61312210 missense probably damaging 1.00
R8007:Ppargc1b UTSW 18 61310494 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- GGCCAGAAGTTCCCTTAGGATAG -3'
(R):5'- GCCTTGTACGGAACTGCATAAG -3'

Sequencing Primer
(F):5'- GTTCCCTTAGGATAGAGAACTCAGTC -3'
(R):5'- GCATAAGCACCTCACTTCGG -3'
Posted On2014-09-18