Incidental Mutation 'R2112:Luc7l'
ID232700
Institutional Source Beutler Lab
Gene Symbol Luc7l
Ensembl Gene ENSMUSG00000024188
Gene NameLuc7-like
Synonyms
MMRRC Submission 040116-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R2112 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location26252910-26285504 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 26255127 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025023] [ENSMUST00000114976] [ENSMUST00000119928] [ENSMUST00000119928] [ENSMUST00000140427] [ENSMUST00000148894] [ENSMUST00000154235] [ENSMUST00000155151] [ENSMUST00000155151]
Predicted Effect probably null
Transcript: ENSMUST00000025023
SMART Domains Protein: ENSMUSP00000025023
Gene: ENSMUSG00000024188

DomainStartEndE-ValueType
Pfam:LUC7 4 260 3.1e-95 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000114976
SMART Domains Protein: ENSMUSP00000110627
Gene: ENSMUSG00000024188

DomainStartEndE-ValueType
Pfam:LUC7 5 249 2.5e-85 PFAM
low complexity region 327 336 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119928
SMART Domains Protein: ENSMUSP00000113405
Gene: ENSMUSG00000024188

DomainStartEndE-ValueType
Pfam:LUC7 4 260 3.1e-95 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000119928
SMART Domains Protein: ENSMUSP00000113405
Gene: ENSMUSG00000024188

DomainStartEndE-ValueType
Pfam:LUC7 4 260 3.1e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133032
Predicted Effect probably benign
Transcript: ENSMUST00000140427
SMART Domains Protein: ENSMUSP00000122258
Gene: ENSMUSG00000024188

DomainStartEndE-ValueType
Pfam:LUC7 1 168 1.5e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148894
Predicted Effect probably benign
Transcript: ENSMUST00000154235
Predicted Effect probably null
Transcript: ENSMUST00000155151
SMART Domains Protein: ENSMUSP00000120409
Gene: ENSMUSG00000024188

DomainStartEndE-ValueType
Pfam:LUC7 1 69 7.4e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000155151
SMART Domains Protein: ENSMUSP00000120409
Gene: ENSMUSG00000024188

DomainStartEndE-ValueType
Pfam:LUC7 1 69 7.4e-23 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The LUC7L gene may represent a mammalian heterochromatic gene, encoding a putative RNA-binding protein similar to the yeast Luc7p subunit of the U1 snRNP splicing complex that is normally required for 5-prime splice site selection (Tufarelli et al., 2001 [PubMed 11170747]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a mutant allele producing a truncated product lacked any obvious phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik C T 10: 3,126,459 noncoding transcript Het
Adam1b A G 5: 121,500,714 probably benign Het
Adprhl1 A G 8: 13,248,694 Y79H probably damaging Het
Ambra1 T A 2: 91,875,787 W746R probably damaging Het
Ankhd1 A T 18: 36,641,626 K1420I probably damaging Het
Ap1b1 T C 11: 5,015,613 F51L probably damaging Het
Arhgap24 A C 5: 102,892,500 R434S probably damaging Het
Arhgap29 T C 3: 122,011,561 L525P probably benign Het
Arpc1b T C 5: 145,123,769 Y124H probably damaging Het
Arr3 T A X: 100,614,641 F269L possibly damaging Het
Atp11b G T 3: 35,837,528 V830F probably damaging Het
Ccdc71l T A 12: 32,379,230 F83I probably damaging Het
Cdh23 G T 10: 60,305,583 F3127L probably damaging Het
Cldn15 T A 5: 136,968,162 M19K possibly damaging Het
Cog4 A G 8: 110,858,582 Y292C possibly damaging Het
Col12a1 A G 9: 79,643,899 V2145A possibly damaging Het
Col5a3 T C 9: 20,809,777 I110V unknown Het
Cps1 T A 1: 67,176,980 D821E probably benign Het
Crnkl1 A T 2: 145,930,697 Y153* probably null Het
Dock10 T A 1: 80,505,642 K2082M probably damaging Het
Dock10 T C 1: 80,505,643 K2083E probably damaging Het
Dst T C 1: 34,169,178 S737P probably damaging Het
Dthd1 T C 5: 62,821,908 Y304H probably damaging Het
Dthd1 T C 5: 62,842,879 S515P probably damaging Het
Etf1 A T 18: 34,909,101 probably null Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Galt A G 4: 41,758,245 T337A probably benign Het
Gbp4 A G 5: 105,135,176 L76P possibly damaging Het
Gcfc2 C A 6: 81,923,778 D24E probably benign Het
Gigyf2 A G 1: 87,440,730 H1044R probably damaging Het
Glg1 T C 8: 111,192,546 D315G probably damaging Het
Gm4787 C T 12: 81,377,833 C517Y probably damaging Het
Gnl3l A G X: 150,997,294 S217P probably damaging Het
Gpr37 T C 6: 25,669,381 Y488C possibly damaging Het
Hap1 T C 11: 100,353,999 D240G probably benign Het
Hhla1 C G 15: 65,936,383 W271S probably benign Het
Hmgxb3 T C 18: 61,155,386 R470G possibly damaging Het
Inpp5a A G 7: 139,574,961 D332G probably damaging Het
Insr A G 8: 3,169,748 S925P probably benign Het
Isoc2b T A 7: 4,849,475 D171V probably damaging Het
Kif20b T C 19: 34,931,732 I223T probably benign Het
Krt6b T C 15: 101,678,564 T258A possibly damaging Het
Lipo4 G A 19: 33,511,526 P219L probably benign Het
Madd T C 2: 91,176,976 K264E possibly damaging Het
Mcf2l A T 8: 13,001,867 K433N probably damaging Het
Mob3b A T 4: 35,083,795 N131K probably damaging Het
Mtus1 G T 8: 41,022,571 P819T probably damaging Het
Myo15 T C 11: 60,494,168 F1699L probably damaging Het
Nav1 C T 1: 135,449,004 R1694Q probably damaging Het
Neb G C 2: 52,328,764 T78S probably damaging Het
Nek2 T C 1: 191,827,208 V275A probably benign Het
Nfatc1 A T 18: 80,635,664 C836* probably null Het
Nos1 T C 5: 117,936,571 V1060A probably benign Het
Notch3 T A 17: 32,144,610 I1160F probably benign Het
Nox4 T C 7: 87,372,008 L476P probably damaging Het
Npc1 A T 18: 12,213,472 N222K possibly damaging Het
Nrn1l C A 8: 105,894,746 H109Q possibly damaging Het
Olfr1206 T C 2: 88,865,201 S199P possibly damaging Het
Olfr213 T C 6: 116,540,650 Y66H possibly damaging Het
Olfr57 T C 10: 79,035,414 L206P probably damaging Het
Olfr727 G T 14: 50,126,623 L15F probably damaging Het
Olfr944 T C 9: 39,217,779 Y141H probably benign Het
Olfr952 C A 9: 39,426,670 V134L probably benign Het
Pcnt T C 10: 76,420,526 K627E probably damaging Het
Plch1 T A 3: 63,722,806 T514S probably damaging Het
Ppargc1b G A 18: 61,311,250 P297S probably benign Het
Ppig A G 2: 69,750,107 T662A unknown Het
Prdm2 A C 4: 143,131,936 S1595A probably benign Het
Ptpn5 T A 7: 47,083,142 T318S probably benign Het
Ralgps2 A G 1: 156,832,708 Y265H probably damaging Het
Seh1l T C 18: 67,787,179 I182T probably damaging Het
Slc12a6 T C 2: 112,356,485 I943T probably damaging Het
Slc5a5 A T 8: 70,889,751 probably null Het
Sparcl1 T A 5: 104,088,423 Q488L probably damaging Het
Sphkap T G 1: 83,275,881 K1382N probably benign Het
Sybu T C 15: 44,673,335 S532G probably benign Het
Syde2 G A 3: 145,998,486 G131S possibly damaging Het
Taok1 C T 11: 77,571,646 V206I probably benign Het
Tas1r2 G T 4: 139,655,355 M101I probably benign Het
Trpc6 C T 9: 8,656,612 T680I probably damaging Het
Trub1 T C 19: 57,485,214 probably null Het
Tspan1 G T 4: 116,163,688 probably null Het
Ttc28 G A 5: 111,276,273 E1438K probably damaging Het
Ubr3 A G 2: 69,977,792 T1206A possibly damaging Het
Usp40 A G 1: 87,950,214 I1117T probably benign Het
Usp43 G T 11: 67,921,710 N113K probably damaging Het
Vcan T A 13: 89,693,303 D414V probably damaging Het
Vmn1r202 T A 13: 22,501,734 Y171F possibly damaging Het
Wdr66 G A 5: 123,254,375 probably benign Het
Zfp142 A G 1: 74,573,636 S451P probably damaging Het
Zfp516 A G 18: 82,957,411 D578G probably damaging Het
Zfp90 G A 8: 106,425,488 C611Y probably damaging Het
Zfp954 A G 7: 7,115,610 C312R probably damaging Het
Zmym3 A T X: 101,407,387 V1208D probably damaging Het
Other mutations in Luc7l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02054:Luc7l APN 17 26279340 utr 3 prime probably benign
IGL02141:Luc7l APN 17 26253080 missense probably damaging 1.00
R0658:Luc7l UTSW 17 26266322 missense probably damaging 1.00
R1114:Luc7l UTSW 17 26275858 splice site probably benign
R1868:Luc7l UTSW 17 26280056 utr 3 prime probably benign
R2286:Luc7l UTSW 17 26280046 utr 3 prime probably benign
R2864:Luc7l UTSW 17 26266361 missense probably damaging 1.00
R2865:Luc7l UTSW 17 26266361 missense probably damaging 1.00
R3040:Luc7l UTSW 17 26277619 utr 3 prime probably benign
R4319:Luc7l UTSW 17 26277619 utr 3 prime probably benign
R4384:Luc7l UTSW 17 26279962 splice site probably benign
R5160:Luc7l UTSW 17 26267297 missense probably benign 0.27
R5330:Luc7l UTSW 17 26275733 nonsense probably null
R5331:Luc7l UTSW 17 26275733 nonsense probably null
R7220:Luc7l UTSW 17 26253245 start gained probably benign
R7559:Luc7l UTSW 17 26255115 missense probably damaging 1.00
X0026:Luc7l UTSW 17 26277575 missense probably damaging 1.00
Z1088:Luc7l UTSW 17 26267255 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCGTCCAGGTGTATTAATTTTGCC -3'
(R):5'- TGCTGTGTGAGTCCTAACACTC -3'

Sequencing Primer
(F):5'- CCAGATAGCCTTGTGTAGTGAATGAG -3'
(R):5'- TGGAACTCACTCTGTAGACCAGG -3'
Posted On2014-09-18