Incidental Mutation 'R2158:Mapk11'
ID235013
Institutional Source Beutler Lab
Gene Symbol Mapk11
Ensembl Gene ENSMUSG00000053137
Gene Namemitogen-activated protein kinase 11
SynonymsP38b, p38beta, Prkm11, Sapk2
MMRRC Submission 040161-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2158 (G1)
Quality Score223
Status Validated
Chromosome15
Chromosomal Location89142486-89149628 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 89146372 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 106 (T106M)
Ref Sequence ENSEMBL: ENSMUSP00000086204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088823]
Predicted Effect probably damaging
Transcript: ENSMUST00000088823
AA Change: T106M

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000086204
Gene: ENSMUSG00000053137
AA Change: T106M

DomainStartEndE-ValueType
S_TKc 24 308 1.67e-84 SMART
low complexity region 313 325 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230734
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of protein kinases that are involved in the integration of biochemical signals for a wide variety of cellular processes, including cell proliferation, differentiation, transcriptional regulation, and development. The encoded protein can be activated by proinflammatory cytokines and environmental stresses through phosphorylation by mitogen activated protein kinase kinases (MKKs). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik T C 19: 3,716,608 V65A possibly damaging Het
4930402F06Rik A T 2: 35,385,668 S38T possibly damaging Het
Adam4 A G 12: 81,421,763 L28S probably damaging Het
Agmo T A 12: 37,357,710 F198I probably damaging Het
Akap7 A G 10: 25,171,164 V45A probably damaging Het
Amotl1 G T 9: 14,575,169 N476K probably benign Het
Apcs A G 1: 172,894,533 L82P probably damaging Het
Armc3 C A 2: 19,248,633 P195Q probably damaging Het
Astn2 A T 4: 66,404,254 L36Q unknown Het
Atad2 A T 15: 58,098,566 S870T possibly damaging Het
Bmp10 A T 6: 87,434,080 D285V probably benign Het
Caskin1 T C 17: 24,505,154 V972A probably benign Het
Ccdc141 T A 2: 77,030,671 N921Y probably damaging Het
Cntnap5b A T 1: 100,390,572 D1019V probably damaging Het
Eml5 T C 12: 98,843,946 probably benign Het
Evi5l T C 8: 4,193,195 Y360H probably damaging Het
Ewsr1 A G 11: 5,091,450 probably benign Het
Fn3k A T 11: 121,448,886 N158I probably damaging Het
Galnt17 C T 5: 130,906,702 R381Q probably damaging Het
Golga3 A T 5: 110,187,361 K180N probably damaging Het
Hipk1 A G 3: 103,760,538 L571P probably damaging Het
Hormad2 T A 11: 4,424,808 K69* probably null Het
Hspg2 A T 4: 137,517,604 D880V probably damaging Het
Ido2 T A 8: 24,540,636 D226V probably damaging Het
Irs3 A G 5: 137,644,699 F159S probably damaging Het
Itgb1bp1 T C 12: 21,276,859 T38A probably damaging Het
Kif11 A G 19: 37,410,614 I749V probably benign Het
Lrp1b T G 2: 40,879,555 M2811L probably benign Het
Lysmd3 A G 13: 81,669,618 Y238C probably damaging Het
Mdga2 C T 12: 66,689,381 V358I possibly damaging Het
Muc4 C T 16: 32,754,563 T1479I probably benign Het
Myom1 T C 17: 71,064,597 V578A possibly damaging Het
Nek10 T G 14: 14,885,047 probably null Het
Nid2 G A 14: 19,778,043 G516S probably benign Het
Olfr328 T A 11: 58,551,942 Q99L probably damaging Het
Olfr620 G C 7: 103,612,236 T39R possibly damaging Het
Olfr645 T G 7: 104,084,826 T85P probably benign Het
Olfr69 G T 7: 103,767,961 C145* probably null Het
Olfr728 T A 14: 50,140,123 N172I probably damaging Het
Olfr930 T C 9: 38,930,579 M136T probably damaging Het
Pde4dip A T 3: 97,757,621 C333S probably benign Het
Pglyrp2 T A 17: 32,418,248 I269F probably benign Het
Plch1 A G 3: 63,721,234 V536A probably benign Het
Popdc2 T A 16: 38,362,826 L57Q probably damaging Het
Pramef17 T C 4: 143,994,315 R19G possibly damaging Het
Riox1 A G 12: 83,950,935 K82E probably benign Het
Rnasel G A 1: 153,754,901 V388M probably damaging Het
Smc1b A G 15: 85,121,851 probably benign Het
Snx25 A G 8: 46,041,407 S814P probably damaging Het
Spta1 A T 1: 174,229,258 H1859L probably benign Het
Strc T C 2: 121,365,862 I1562V probably benign Het
Taar5 T A 10: 23,971,088 I128N probably damaging Het
Ttc28 C T 5: 111,177,617 probably benign Het
Vcan A T 13: 89,703,529 M1104K possibly damaging Het
Vnn1 C T 10: 23,900,755 Q335* probably null Het
Zic1 T C 9: 91,364,893 D42G possibly damaging Het
Other mutations in Mapk11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01744:Mapk11 APN 15 89146843 splice site probably benign
IGL02164:Mapk11 APN 15 89145448 critical splice acceptor site probably null
IGL02825:Mapk11 APN 15 89146382 missense probably damaging 1.00
E0370:Mapk11 UTSW 15 89146513 missense probably damaging 1.00
R1764:Mapk11 UTSW 15 89144391 critical splice donor site probably null
R3149:Mapk11 UTSW 15 89145450 unclassified probably null
R3150:Mapk11 UTSW 15 89145450 unclassified probably null
R3730:Mapk11 UTSW 15 89145115 missense probably benign 0.27
R4319:Mapk11 UTSW 15 89146743 missense probably damaging 1.00
R4424:Mapk11 UTSW 15 89145373 critical splice donor site probably null
R4632:Mapk11 UTSW 15 89146376 missense probably damaging 1.00
R4783:Mapk11 UTSW 15 89149488 missense probably damaging 0.98
R4937:Mapk11 UTSW 15 89146482 missense probably benign
R5422:Mapk11 UTSW 15 89146285 missense probably damaging 1.00
R5511:Mapk11 UTSW 15 89145177 critical splice acceptor site probably null
R5914:Mapk11 UTSW 15 89145835 missense probably benign 0.21
R5972:Mapk11 UTSW 15 89144184 missense probably benign 0.34
R7290:Mapk11 UTSW 15 89144308 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCGAGTGGATATACTGCAGAG -3'
(R):5'- CTAAGCTGTGATCCTGCCTC -3'

Sequencing Primer
(F):5'- AGCAGACCGAGTGAGCC -3'
(R):5'- CCTCGGTTCCCTGACCAG -3'
Posted On2014-10-01