Incidental Mutation 'R3150:Mapk11'
ID271646
Institutional Source Beutler Lab
Gene Symbol Mapk11
Ensembl Gene ENSMUSG00000053137
Gene Namemitogen-activated protein kinase 11
SynonymsP38b, p38beta, Prkm11, Sapk2
MMRRC Submission 040602-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3150 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location89142486-89149628 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 89145450 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000086207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088823] [ENSMUST00000088827]
Predicted Effect probably null
Transcript: ENSMUST00000088823
SMART Domains Protein: ENSMUSP00000086204
Gene: ENSMUSG00000053137

DomainStartEndE-ValueType
S_TKc 24 308 1.67e-84 SMART
low complexity region 313 325 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000088827
SMART Domains Protein: ENSMUSP00000086207
Gene: ENSMUSG00000022610

DomainStartEndE-ValueType
S_TKc 27 311 1.63e-96 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230734
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of protein kinases that are involved in the integration of biochemical signals for a wide variety of cellular processes, including cell proliferation, differentiation, transcriptional regulation, and development. The encoded protein can be activated by proinflammatory cytokines and environmental stresses through phosphorylation by mitogen activated protein kinase kinases (MKKs). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C A 7: 28,154,195 T1528N probably benign Het
Akna A T 4: 63,395,353 S178T possibly damaging Het
BC067074 A T 13: 113,351,760 Q105H probably damaging Het
Cabin1 A G 10: 75,656,911 L1850P probably damaging Het
Ccdc178 G T 18: 22,067,652 A416E possibly damaging Het
Ces1g C T 8: 93,325,816 V282I probably benign Het
Col4a3 T G 1: 82,657,137 probably null Het
Crat C T 2: 30,413,859 probably null Het
Csf2ra C A 19: 61,227,320 A16S possibly damaging Het
Cyp4f18 T C 8: 71,993,200 D317G possibly damaging Het
Ddb1 T A 19: 10,612,982 M291K probably benign Het
Gfod2 C T 8: 105,717,221 G230D probably benign Het
Git2 A G 5: 114,730,349 S257P probably damaging Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hjurp A G 1: 88,266,561 probably benign Het
Hnrnph1 T A 11: 50,385,792 V439E probably benign Het
Itgad C A 7: 128,190,981 H651N possibly damaging Het
Map3k20 C T 2: 72,371,992 T189M probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Nmral1 G A 16: 4,716,469 T36I probably damaging Het
Olfr1231 C T 2: 89,303,218 V125M possibly damaging Het
Olfr1475 A G 19: 13,479,460 V246A probably damaging Het
Olfr860 A G 9: 19,846,214 I135T possibly damaging Het
Padi6 A G 4: 140,735,389 L307P probably damaging Het
Pkd1 G T 17: 24,579,791 R2691L probably benign Het
Ppp2r2a G A 14: 67,023,765 R169W probably damaging Het
Prdm1 A T 10: 44,458,492 probably null Het
Robo1 C T 16: 72,970,269 P443L possibly damaging Het
Rtn4 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 11: 29,693,308 probably benign Het
Shprh A G 10: 11,170,030 H865R probably damaging Het
Spats1 A T 17: 45,464,554 S15T probably damaging Het
Srgap2 T C 1: 131,292,589 T216A probably benign Het
Sry ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTG Y: 2,662,944 probably benign Het
Tie1 G A 4: 118,475,825 A902V probably damaging Het
Usp22 T C 11: 61,160,581 Q312R probably damaging Het
Vmn2r32 T C 7: 7,472,555 Y443C probably benign Het
Vps13d A C 4: 145,086,790 D3274E probably damaging Het
Wdr62 A T 7: 30,271,670 N167K possibly damaging Het
Xpo5 A G 17: 46,242,247 probably null Het
Zswim7 A T 11: 62,273,785 I43N possibly damaging Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Mapk11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01744:Mapk11 APN 15 89146843 splice site probably benign
IGL02164:Mapk11 APN 15 89145448 critical splice acceptor site probably null
IGL02825:Mapk11 APN 15 89146382 missense probably damaging 1.00
E0370:Mapk11 UTSW 15 89146513 missense probably damaging 1.00
R1764:Mapk11 UTSW 15 89144391 critical splice donor site probably null
R2158:Mapk11 UTSW 15 89146372 missense probably damaging 0.98
R3149:Mapk11 UTSW 15 89145450 unclassified probably null
R3730:Mapk11 UTSW 15 89145115 missense probably benign 0.27
R4319:Mapk11 UTSW 15 89146743 missense probably damaging 1.00
R4424:Mapk11 UTSW 15 89145373 critical splice donor site probably null
R4632:Mapk11 UTSW 15 89146376 missense probably damaging 1.00
R4783:Mapk11 UTSW 15 89149488 missense probably damaging 0.98
R4937:Mapk11 UTSW 15 89146482 missense probably benign
R5422:Mapk11 UTSW 15 89146285 missense probably damaging 1.00
R5511:Mapk11 UTSW 15 89145177 critical splice acceptor site probably null
R5914:Mapk11 UTSW 15 89145835 missense probably benign 0.21
R5972:Mapk11 UTSW 15 89144184 missense probably benign 0.34
R7290:Mapk11 UTSW 15 89144308 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTACACTGTAGAGCTGTGGC -3'
(R):5'- GGGACCAGCTTTTAGAAAGGC -3'

Sequencing Primer
(F):5'- AGCCCCGTGTAATGTGTGATATG -3'
(R):5'- CTTCTAAGCTGATGGGTGTCTGTCC -3'
Posted On2015-03-25