Incidental Mutation 'R2199:Nmt1'
ID 238572
Institutional Source Beutler Lab
Gene Symbol Nmt1
Ensembl Gene ENSMUSG00000020936
Gene Name N-myristoyltransferase 1
Synonyms
MMRRC Submission 040201-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2199 (G1)
Quality Score 219
Status Not validated
Chromosome 11
Chromosomal Location 103028190-103068912 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 103063856 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 405 (S405T)
Ref Sequence ENSEMBL: ENSMUSP00000021314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021314]
AlphaFold O70310
Predicted Effect probably damaging
Transcript: ENSMUST00000021314
AA Change: S405T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021314
Gene: ENSMUSG00000020936
AA Change: S405T

DomainStartEndE-ValueType
low complexity region 55 67 N/A INTRINSIC
Pfam:NMT 137 294 6.7e-77 PFAM
Pfam:NMT_C 308 495 1.4e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181125
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myristate, a rare 14-carbon saturated fatty acid, is cotranslationally attached by an amide linkage to the N-terminal glycine residue of cellular and viral proteins with diverse functions. N-myristoyltransferase (NMT; EC 2.3.1.97) catalyzes the transfer of myristate from CoA to proteins. N-myristoylation appears to be irreversible and is required for full expression of the biologic activities of several N-myristoylated proteins, including the alpha subunit of the signal-transducing guanine nucleotide-binding protein (G protein) GO (GNAO1; MIM 139311) (Duronio et al., 1992 [PubMed 1570339]).[supplied by OMIM, Nov 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality between E3.5 and E7.5. Heterozygotes show partial prenatal lethality. Mice homozygous for a conditional allele knocked out in T cells exhibit reduced T cell, double positive T cell and single positive T cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,335,624 I119V probably benign Het
Arfgap2 T A 2: 91,265,692 probably null Het
Ccm2 T C 11: 6,590,790 V216A probably damaging Het
Ctdspl2 T C 2: 121,987,029 probably null Het
Dmxl2 T C 9: 54,376,243 T2769A probably benign Het
Dnah3 C T 7: 119,951,569 V3165M possibly damaging Het
Dnajc1 A C 2: 18,308,899 F137C probably damaging Het
Gli2 A T 1: 118,837,648 D924E possibly damaging Het
Gnrhr T C 5: 86,197,818 N3S probably benign Het
Grhl1 G T 12: 24,612,170 R536L probably damaging Het
Hormad1 T C 3: 95,567,722 probably null Het
Il20 T A 1: 130,910,739 I74L probably benign Het
Ints11 A G 4: 155,875,281 K115R probably benign Het
Irx4 A T 13: 73,265,601 E63D probably benign Het
Itch A C 2: 155,202,221 Q482P probably benign Het
Kctd8 C A 5: 69,341,245 M19I probably benign Het
Klhl31 T C 9: 77,650,101 L33P probably damaging Het
Lrp1 A T 10: 127,546,840 C3691S probably damaging Het
Lrrc39 A G 3: 116,570,961 D167G probably damaging Het
Lrrd1 A T 5: 3,866,478 I832L possibly damaging Het
Lrriq1 A G 10: 103,068,913 V1620A probably damaging Het
Ltbr T C 6: 125,312,061 K213E probably benign Het
Megf8 T A 7: 25,339,614 D883E possibly damaging Het
Nsd3 G T 8: 25,666,057 V547F probably damaging Het
Olfr1215 A G 2: 89,001,550 V246A probably damaging Het
Olfr828 C A 9: 18,815,923 V124F probably damaging Het
Otud7a A G 7: 63,757,656 K569R possibly damaging Het
Otud7b A G 3: 96,155,772 Y776C probably damaging Het
Pcdh15 T C 10: 74,170,509 I73T probably damaging Het
Rnf213 A T 11: 119,460,009 H3890L probably benign Het
Sall3 T C 18: 80,971,870 T948A probably benign Het
Slc44a3 T C 3: 121,513,744 I198V probably benign Het
Slc9a3r2 T C 17: 24,640,596 E174G probably null Het
Smg7 C A 1: 152,854,328 D405Y probably damaging Het
Synpo2l A G 14: 20,661,919 L211S probably benign Het
Thsd7b A G 1: 130,218,158 Y1601C probably benign Het
Traf4 T C 11: 78,159,980 Y450C probably damaging Het
Trpv1 A G 11: 73,240,251 K239E probably damaging Het
Ttn C T 2: 76,754,806 G20302S probably damaging Het
Ube2o A G 11: 116,544,745 S406P probably benign Het
Xrn2 C T 2: 147,024,750 A80V probably damaging Het
Zfp616 C T 11: 74,084,630 T575I possibly damaging Het
Other mutations in Nmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Nmt1 APN 11 103060076 critical splice acceptor site probably null
IGL02058:Nmt1 APN 11 103052290 missense probably benign 0.00
IGL02582:Nmt1 APN 11 103064799 missense possibly damaging 0.94
cropped UTSW 11 103056459 missense probably damaging 1.00
R0092:Nmt1 UTSW 11 103046493 missense probably damaging 1.00
R1401:Nmt1 UTSW 11 103057481 missense probably damaging 0.99
R1827:Nmt1 UTSW 11 103064838 missense probably damaging 1.00
R1878:Nmt1 UTSW 11 103052251 missense probably benign
R3930:Nmt1 UTSW 11 103052233 missense probably benign 0.37
R4373:Nmt1 UTSW 11 103043200 missense probably damaging 0.99
R4648:Nmt1 UTSW 11 103063917 missense probably damaging 1.00
R5666:Nmt1 UTSW 11 103058215 nonsense probably null
R6908:Nmt1 UTSW 11 103058254 missense possibly damaging 0.92
R7315:Nmt1 UTSW 11 103060183 missense probably benign
R7473:Nmt1 UTSW 11 103046400 missense probably benign 0.05
R7504:Nmt1 UTSW 11 103056459 missense probably damaging 1.00
R8548:Nmt1 UTSW 11 103043226 missense possibly damaging 0.80
R8913:Nmt1 UTSW 11 103057445 missense probably damaging 1.00
X0018:Nmt1 UTSW 11 103028586 missense probably benign 0.01
Z1177:Nmt1 UTSW 11 103055213 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AATTGTTACACGGCTCTGCTC -3'
(R):5'- GTGCTCACTAGTACTACAAAGCC -3'

Sequencing Primer
(F):5'- CTTACATGTCAGCGGGCTCTAAAG -3'
(R):5'- TCACTAGTACTACAAAGCCCCCAC -3'
Posted On 2014-10-02