Incidental Mutation 'R2210:Ube2d3'
ID239302
Institutional Source Beutler Lab
Gene Symbol Ube2d3
Ensembl Gene ENSMUSG00000078578
Gene Nameubiquitin-conjugating enzyme E2D 3
Synonyms9430029A22Rik, 1100001F19Rik
MMRRC Submission 040212-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.643) question?
Stock #R2210 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location135438149-135468198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 135463041 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 132 (D132E)
Ref Sequence ENSEMBL: ENSMUSP00000143301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106291] [ENSMUST00000166033] [ENSMUST00000196446] [ENSMUST00000196591] [ENSMUST00000197134] [ENSMUST00000197539] [ENSMUST00000197859] [ENSMUST00000198685] [ENSMUST00000198748] [ENSMUST00000199613]
Predicted Effect probably benign
Transcript: ENSMUST00000106291
AA Change: D132E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101898
Gene: ENSMUSG00000078578
AA Change: D132E

DomainStartEndE-ValueType
UBCc 4 147 1.61e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166033
AA Change: D132E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130096
Gene: ENSMUSG00000078578
AA Change: D132E

DomainStartEndE-ValueType
UBCc 4 147 1.61e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196248
Predicted Effect probably benign
Transcript: ENSMUST00000196446
AA Change: D132E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142974
Gene: ENSMUSG00000078578
AA Change: D132E

DomainStartEndE-ValueType
UBCc 4 147 1.61e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196564
Predicted Effect probably benign
Transcript: ENSMUST00000196591
SMART Domains Protein: ENSMUSP00000143758
Gene: ENSMUSG00000078578

DomainStartEndE-ValueType
UBCc 4 73 8.5e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196878
Predicted Effect probably benign
Transcript: ENSMUST00000197134
AA Change: D132E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143606
Gene: ENSMUSG00000078578
AA Change: D132E

DomainStartEndE-ValueType
UBCc 4 147 2.16e-73 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197539
AA Change: D132E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143065
Gene: ENSMUSG00000078578
AA Change: D132E

DomainStartEndE-ValueType
UBCc 4 147 1.61e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197814
Predicted Effect probably benign
Transcript: ENSMUST00000197859
AA Change: D132E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143608
Gene: ENSMUSG00000078578
AA Change: D132E

DomainStartEndE-ValueType
UBCc 4 147 1.61e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198685
AA Change: D132E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142612
Gene: ENSMUSG00000078578
AA Change: D132E

DomainStartEndE-ValueType
UBCc 4 132 3.5e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198748
SMART Domains Protein: ENSMUSP00000142763
Gene: ENSMUSG00000078578

DomainStartEndE-ValueType
Pfam:UQ_con 5 45 8.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199613
AA Change: D132E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143301
Gene: ENSMUSG00000078578
AA Change: D132E

DomainStartEndE-ValueType
UBCc 4 147 1.61e-72 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme functions in the ubiquitination of the tumor-suppressor protein p53, which is induced by an E3 ubiquitin-protein ligase. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016L21Rik C G 5: 114,942,289 R28G probably damaging Het
Adgrb1 C T 15: 74,547,704 A798V probably damaging Het
Ash1l G T 3: 89,066,298 D2555Y probably damaging Het
Atr G A 9: 95,907,300 R1503Q probably damaging Het
Cbln3 T A 14: 55,883,926 I88F possibly damaging Het
Cct7 G A 6: 85,459,230 G41D probably damaging Het
Cd1d2 G T 3: 86,987,734 A138S possibly damaging Het
Dct T C 14: 118,043,149 I152V probably benign Het
Dgkq C A 5: 108,660,523 R58L probably damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Gm4884 A T 7: 41,043,546 E313V possibly damaging Het
Hectd1 A T 12: 51,806,462 I92K probably damaging Het
Icam1 A G 9: 21,019,033 E61G probably damaging Het
Itgb2l C T 16: 96,426,221 V541M possibly damaging Het
Lmtk2 A G 5: 144,147,609 E154G probably damaging Het
Majin C A 19: 6,222,698 H223N possibly damaging Het
Mc4r A T 18: 66,859,395 F216I probably damaging Het
Mettl7b T A 10: 128,958,722 K244N probably damaging Het
Muc4 AG AGG 16: 32,755,176 probably null Het
Obscn A T 11: 59,068,087 V3379D probably damaging Het
Olfr948 A T 9: 39,318,793 S274T probably damaging Het
Pde4b A T 4: 102,597,475 N346I probably damaging Het
Pitpnm1 T C 19: 4,105,253 S331P probably damaging Het
Plcb2 T A 2: 118,717,503 I437F probably damaging Het
Pramef17 T A 4: 143,994,219 M51L probably benign Het
Prr12 A G 7: 45,049,351 probably benign Het
Pus7l T G 15: 94,540,292 D224A possibly damaging Het
Sh3pxd2a A G 19: 47,267,343 S1007P possibly damaging Het
Stac G A 9: 111,602,570 P238S probably damaging Het
Tmem107 A G 11: 69,071,270 E45G possibly damaging Het
Triml2 T C 8: 43,183,360 Y61H probably damaging Het
Uba2 T C 7: 34,163,162 D95G probably damaging Het
Unc5d A G 8: 28,761,797 I216T probably damaging Het
Other mutations in Ube2d3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03374:Ube2d3 APN 3 135460083 splice site probably null
IGL03410:Ube2d3 APN 3 135465217 missense probably damaging 1.00
R1772:Ube2d3 UTSW 3 135465211 missense probably benign 0.02
R2047:Ube2d3 UTSW 3 135465206 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGGTGCCATCAGAGCTTTC -3'
(R):5'- CTCACTGTCATGTATGCTATGAGC -3'

Sequencing Primer
(F):5'- GGTGCCATCAGAGCTTTCATTTC -3'
(R):5'- TAGGCAGCCTAGACTACCTTC -3'
Posted On2014-10-15