Incidental Mutation 'R2224:BC051142'
ID241580
Institutional Source Beutler Lab
Gene Symbol BC051142
Ensembl Gene ENSMUSG00000057246
Gene NamecDNA sequence BC051142
Synonyms
MMRRC Submission 040225-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.391) question?
Stock #R2224 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location34398820-34460734 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 34448763 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078615] [ENSMUST00000097348] [ENSMUST00000114175] [ENSMUST00000139063] [ENSMUST00000223957]
Predicted Effect probably null
Transcript: ENSMUST00000078615
SMART Domains Protein: ENSMUSP00000077685
Gene: ENSMUSG00000057246

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 144 167 N/A INTRINSIC
low complexity region 246 272 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
low complexity region 364 391 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000097348
SMART Domains Protein: ENSMUSP00000094961
Gene: ENSMUSG00000057246

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 151 174 N/A INTRINSIC
low complexity region 253 279 N/A INTRINSIC
low complexity region 335 345 N/A INTRINSIC
low complexity region 371 398 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114175
SMART Domains Protein: ENSMUSP00000109812
Gene: ENSMUSG00000057246

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 142 165 N/A INTRINSIC
SCOP:d1i7qa_ 227 277 5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139063
SMART Domains Protein: ENSMUSP00000121839
Gene: ENSMUSG00000057246

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000223765
Predicted Effect probably null
Transcript: ENSMUST00000223957
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T G 16: 14,472,068 L1416R probably damaging Het
Aen C A 7: 78,902,451 T15K probably benign Het
Ahnak G A 19: 9,012,991 probably benign Het
Ar T A X: 98,151,331 M517K probably benign Het
Arsb T A 13: 93,794,171 F216I probably damaging Het
Atg9b A G 5: 24,386,395 V735A possibly damaging Het
Brinp3 C T 1: 146,901,920 Q702* probably null Het
Btbd9 C A 17: 30,527,346 A169S probably damaging Het
Cacna1h T C 17: 25,385,943 N1132S probably benign Het
Ccdc33 A G 9: 58,082,022 S123P probably damaging Het
Cep250 A C 2: 155,991,817 E1886D possibly damaging Het
Chd9 A C 8: 91,011,285 H1515P probably benign Het
Cyp2c68 A G 19: 39,735,582 C213R probably benign Het
Ddx41 G A 13: 55,531,401 T544I probably damaging Het
Dgkk T A X: 6,875,248 D102E probably damaging Het
Eea1 T A 10: 96,020,012 V637D probably damaging Het
Emcn T C 3: 137,404,017 I140T possibly damaging Het
Exo1 A G 1: 175,886,688 probably null Het
Fbxo21 T G 5: 118,008,123 Y597D probably damaging Het
Fbxw20 G C 9: 109,233,582 Q59E possibly damaging Het
Fpr3 T A 17: 17,971,193 V242D probably damaging Het
Fyb A G 15: 6,652,383 Y737C probably damaging Het
Gm17661 GG GGG 2: 90,917,708 noncoding transcript Het
Gm4985 T A X: 23,958,934 M1L probably null Het
Hdac9 C T 12: 34,407,802 V251I probably benign Het
Hoxa10 T C 6: 52,232,636 E52G probably damaging Het
Il17f A G 1: 20,779,375 V55A probably damaging Het
Inpp1 T A 1: 52,790,131 E243V probably benign Het
Leap2 A G 11: 53,422,807 L46P probably damaging Het
Map4k3 A T 17: 80,630,454 D339E probably benign Het
Met A G 6: 17,563,722 probably null Het
Mgam G T 6: 40,764,274 probably null Het
Mrgpra1 A G 7: 47,335,106 V275A possibly damaging Het
Mrgprx2 T A 7: 48,482,860 Q70L probably benign Het
Mtus1 C T 8: 41,082,775 V635M probably damaging Het
Mup18 G T 4: 61,671,891 F133L possibly damaging Het
Naalad2 A T 9: 18,376,533 V267E possibly damaging Het
Nin A T 12: 70,061,230 I196N probably damaging Het
Nkpd1 A T 7: 19,519,820 Y37F probably benign Het
Odc1 A G 12: 17,547,335 I13V probably benign Het
Olfr1024 T A 2: 85,904,755 I100F probably benign Het
Olfr1200 A T 2: 88,767,586 M243K possibly damaging Het
Olfr1377 T C 11: 50,985,232 F177S probably damaging Het
Pard3 A G 8: 127,359,776 I286V probably damaging Het
Pcx T C 19: 4,617,998 I516T possibly damaging Het
Ppp1r9a G T 6: 5,154,074 R1081L probably benign Het
Prpf40b C T 15: 99,303,291 probably benign Het
Rnmt C T 18: 68,305,783 probably benign Het
Sfxn1 A G 13: 54,085,517 T20A possibly damaging Het
Sirt2 A G 7: 28,772,212 probably null Het
Spata31d1a T A 13: 59,703,715 I200L probably benign Het
Spin2g A T X: 34,237,275 I171N possibly damaging Het
Tex45 A G 8: 3,479,249 T245A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Uqcrc2 T A 7: 120,641,714 V73E probably damaging Het
Vmn2r100 A G 17: 19,522,372 K336R probably benign Het
Vmn2r108 A T 17: 20,481,033 Y68* probably null Het
Zbtb4 C T 11: 69,776,358 T163I probably benign Het
Other mutations in BC051142
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00668:BC051142 APN 17 34420420 unclassified probably benign
IGL01516:BC051142 APN 17 34449260 missense possibly damaging 0.90
FR4304:BC051142 UTSW 17 34460055 unclassified probably benign
FR4304:BC051142 UTSW 17 34460077 unclassified probably benign
FR4340:BC051142 UTSW 17 34460060 nonsense probably null
FR4340:BC051142 UTSW 17 34460068 unclassified probably benign
FR4340:BC051142 UTSW 17 34460077 unclassified probably benign
FR4548:BC051142 UTSW 17 34460065 unclassified probably benign
FR4589:BC051142 UTSW 17 34460053 unclassified probably benign
FR4589:BC051142 UTSW 17 34460073 unclassified probably benign
FR4737:BC051142 UTSW 17 34460051 unclassified probably benign
FR4737:BC051142 UTSW 17 34460068 unclassified probably benign
FR4976:BC051142 UTSW 17 34460058 unclassified probably benign
FR4976:BC051142 UTSW 17 34460061 unclassified probably benign
R0046:BC051142 UTSW 17 34460121 critical splice donor site probably null
R0046:BC051142 UTSW 17 34460121 critical splice donor site probably null
R0523:BC051142 UTSW 17 34445499 critical splice donor site probably null
R0661:BC051142 UTSW 17 34459913 missense possibly damaging 0.90
R2937:BC051142 UTSW 17 34421862 missense possibly damaging 0.92
R3932:BC051142 UTSW 17 34443443 missense possibly damaging 0.94
R4210:BC051142 UTSW 17 34460283 unclassified probably benign
R4924:BC051142 UTSW 17 34459977 missense probably damaging 0.96
R5055:BC051142 UTSW 17 34448796 missense possibly damaging 0.83
R5446:BC051142 UTSW 17 34440893 splice site probably null
R6147:BC051142 UTSW 17 34418923 missense possibly damaging 0.95
R6851:BC051142 UTSW 17 34460172 missense possibly damaging 0.66
R6866:BC051142 UTSW 17 34459961 missense possibly damaging 0.66
R7035:BC051142 UTSW 17 34460331 unclassified probably benign
R7077:BC051142 UTSW 17 34440882 missense possibly damaging 0.82
R7468:BC051142 UTSW 17 34417565 intron probably null
R7556:BC051142 UTSW 17 34437717 missense unknown
R7843:BC051142 UTSW 17 34449824 missense possibly damaging 0.92
R7926:BC051142 UTSW 17 34449824 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AAGCCTAGCTGTGAGTTCTCC -3'
(R):5'- TGCACAGGAACAGTTAGATGAC -3'

Sequencing Primer
(F):5'- AGCTGTGAGTTCTCCTTGATTTTC -3'
(R):5'- CAGGAACAGTTAGATGACACAGGC -3'
Posted On2014-10-15