Incidental Mutation 'R2256:Olfr676'
ID243378
Institutional Source Beutler Lab
Gene Symbol Olfr676
Ensembl Gene ENSMUSG00000073915
Gene Nameolfactory receptor 676
SynonymsMOR32-1, GA_x6K02T2PBJ9-7664016-7664969
MMRRC Submission 040256-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R2256 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location105032698-105037750 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105035819 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 207 (Y207C)
Ref Sequence ENSEMBL: ENSMUSP00000151474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098162] [ENSMUST00000219602]
Predicted Effect probably benign
Transcript: ENSMUST00000098162
AA Change: Y207C

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000095765
Gene: ENSMUSG00000073915
AA Change: Y207C

DomainStartEndE-ValueType
Pfam:7tm_4 41 317 3e-113 PFAM
Pfam:7TM_GPCR_Srsx 45 316 4.5e-7 PFAM
Pfam:7tm_1 51 301 1.5e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215533
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219042
Predicted Effect probably benign
Transcript: ENSMUST00000219602
AA Change: Y207C

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 98% (97/99)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
4931409K22Rik C T 5: 24,552,040 probably benign Het
6720489N17Rik A T 13: 62,607,396 I36N probably benign Het
Abcb4 T C 5: 8,958,431 S1200P probably damaging Het
Acadsb A G 7: 131,443,653 Y438C probably benign Het
Acp7 A C 7: 28,614,413 W399G probably damaging Het
Actr3b A G 5: 25,822,405 T113A possibly damaging Het
Adgrv1 T C 13: 81,506,140 D2204G probably benign Het
Ago1 A G 4: 126,441,911 V669A possibly damaging Het
Ang5 T A 14: 43,962,521 L14Q probably null Het
Aoc1 T C 6: 48,906,440 Y417H possibly damaging Het
Arhgap32 T C 9: 32,247,497 I186T probably damaging Het
Atf2 A T 2: 73,845,511 probably null Het
Atg4a A G X: 140,990,235 I91V probably benign Het
Atp7b T G 8: 21,998,266 T1102P probably damaging Het
Bend5 A C 4: 111,431,010 probably benign Het
Camkk2 T C 5: 122,746,335 D341G probably damaging Het
Cast T A 13: 74,739,905 I208L probably damaging Het
Ccdc141 A T 2: 77,132,262 W113R probably damaging Het
Cdk14 T A 5: 4,888,924 M433L probably benign Het
Cel A G 2: 28,561,192 F51S probably damaging Het
Cenpc1 A G 5: 86,016,203 L853S probably damaging Het
Cep162 C A 9: 87,206,914 D972Y probably damaging Het
Clasrp A G 7: 19,586,585 probably benign Het
Cntnap5c T A 17: 58,330,315 N1062K probably benign Het
Col3a1 A G 1: 45,321,632 D74G unknown Het
Copb1 T A 7: 114,253,875 D29V possibly damaging Het
Cox6a1 C T 5: 115,348,848 E35K possibly damaging Het
Cyp2b9 G A 7: 26,173,605 probably null Het
Ddx46 A G 13: 55,647,708 K177E possibly damaging Het
Dmbt1 T C 7: 131,090,494 F823L probably benign Het
Drc7 A T 8: 95,075,009 H666L probably benign Het
Fam228a T C 12: 4,737,775 probably benign Het
Fam71e2 T A 7: 4,771,021 M31L probably benign Het
Fam83e A T 7: 45,728,769 K406* probably null Het
Fam83e A T 7: 45,728,770 K406M possibly damaging Het
Fam90a1a T A 8: 21,963,517 L296Q possibly damaging Het
Fat1 A G 8: 44,950,371 Y53C probably damaging Het
Fhdc1 T C 3: 84,446,046 E624G probably benign Het
Fryl T A 5: 73,072,844 N1657Y possibly damaging Het
Fsip2 T A 2: 82,962,751 D417E probably benign Het
Greb1l A G 18: 10,503,307 M453V possibly damaging Het
Gtf2b A G 3: 142,781,424 D207G probably benign Het
Has3 C A 8: 106,874,256 L117I probably damaging Het
Jmjd1c T A 10: 67,225,294 I1142N probably damaging Het
Lipt2 C T 7: 100,159,394 T38I probably benign Het
Magea2 A T X: 155,027,859 L243Q probably damaging Het
Mast4 A T 13: 102,735,751 C2178S possibly damaging Het
Mctp2 A G 7: 72,185,820 L543P probably damaging Het
Mphosph9 C T 5: 124,283,659 V740I probably benign Het
Mut A T 17: 40,956,319 I595F probably benign Het
Myo1e G A 9: 70,378,373 probably null Het
Nlrc4 A G 17: 74,445,630 I586T probably damaging Het
Nom1 T A 5: 29,437,752 V417D probably damaging Het
Nphs1 A T 7: 30,467,992 I782F possibly damaging Het
Numa1 A G 7: 102,000,791 E1243G probably damaging Het
Olfr1000 T A 2: 85,608,463 Y149F possibly damaging Het
Olfr1254 T C 2: 89,788,470 H294R probably benign Het
Olfr1290 T C 2: 111,489,978 Y60C probably damaging Het
Olfr474 A T 7: 107,955,037 Y132F probably damaging Het
Orai2 C T 5: 136,161,600 V52I probably damaging Het
Osbpl5 A G 7: 143,709,094 C186R probably damaging Het
Osbpl6 A G 2: 76,584,474 E403G probably damaging Het
Padi4 G A 4: 140,759,940 T217I possibly damaging Het
Parm1 C T 5: 91,594,121 T116I possibly damaging Het
Pde4dip T A 3: 97,718,184 Q1366L probably damaging Het
Phgdh T C 3: 98,328,291 K108E probably benign Het
Pold1 T C 7: 44,533,799 probably null Het
Ppp1r37 G T 7: 19,562,018 probably benign Het
Sdk2 T C 11: 113,830,794 N1332S probably benign Het
Sema6d A G 2: 124,664,150 D626G probably damaging Het
Skiv2l2 A T 13: 112,876,512 M890K probably damaging Het
Slc18b1 A G 10: 23,810,922 N212S probably benign Het
Slc2a9 T C 5: 38,453,199 T86A probably damaging Het
Slco1a6 A T 6: 142,091,016 M555K probably benign Het
Sntg2 C T 12: 30,236,688 W302* probably null Het
Spata22 T A 11: 73,340,475 M185K possibly damaging Het
Stk35 T A 2: 129,810,507 Y309* probably null Het
Taar8c A G 10: 24,101,071 V281A probably benign Het
Thoc1 C A 18: 9,993,466 D608E possibly damaging Het
Tmem121b A T 6: 120,492,069 Y562* probably null Het
Tmem121b A G 6: 120,492,071 Y562H probably damaging Het
Tmtc4 A T 14: 122,941,408 I449N probably benign Het
Tmub1 C A 5: 24,446,924 G14V possibly damaging Het
Tmub1 G A 5: 24,447,177 probably benign Het
Tshz2 A G 2: 169,886,477 T529A probably damaging Het
Ugdh A T 5: 65,417,115 probably benign Het
Usp25 A G 16: 77,113,794 K913E probably benign Het
Vgf A G 5: 137,031,547 probably benign Het
Vmn2r19 T A 6: 123,329,886 F451Y probably benign Het
Vmn2r59 A T 7: 42,012,245 C715* probably null Het
Vps9d1 C A 8: 123,245,121 A582S probably benign Het
Xbp1 T G 11: 5,524,841 H247Q probably damaging Het
Zfp319 A T 8: 95,328,501 M358K possibly damaging Het
Zfp438 A T 18: 5,213,508 N483K probably damaging Het
Zfp518b T C 5: 38,671,636 N1009D possibly damaging Het
Zfp644 A T 5: 106,635,845 H945Q probably damaging Het
Zgrf1 T A 3: 127,561,997 S291T probably benign Het
Other mutations in Olfr676
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02034:Olfr676 APN 7 105035390 missense probably benign
IGL02244:Olfr676 APN 7 105035945 missense probably damaging 1.00
IGL03493:Olfr676 APN 7 105035944 missense probably damaging 1.00
R1181:Olfr676 UTSW 7 105035814 missense probably damaging 1.00
R1223:Olfr676 UTSW 7 105035566 missense probably benign 0.01
R1460:Olfr676 UTSW 7 105035708 missense possibly damaging 0.80
R1768:Olfr676 UTSW 7 105035950 missense probably benign 0.00
R2257:Olfr676 UTSW 7 105035819 missense probably benign 0.00
R3846:Olfr676 UTSW 7 105035689 missense probably benign 0.40
R4486:Olfr676 UTSW 7 105035303 missense probably benign 0.00
R4488:Olfr676 UTSW 7 105035303 missense probably benign 0.00
R4489:Olfr676 UTSW 7 105035303 missense probably benign 0.00
R4598:Olfr676 UTSW 7 105036073 missense probably benign 0.19
R4599:Olfr676 UTSW 7 105036073 missense probably benign 0.00
R4701:Olfr676 UTSW 7 105035591 missense probably damaging 1.00
R4855:Olfr676 UTSW 7 105035651 missense probably damaging 0.99
R5083:Olfr676 UTSW 7 105035411 missense probably damaging 1.00
R5743:Olfr676 UTSW 7 105036156 unclassified probably null
R5798:Olfr676 UTSW 7 105036137 missense probably benign 0.00
R6279:Olfr676 UTSW 7 105035671 missense probably benign 0.25
R6300:Olfr676 UTSW 7 105035671 missense probably benign 0.25
R7400:Olfr676 UTSW 7 105035210 missense probably benign
R7672:Olfr676 UTSW 7 105035543 missense probably damaging 1.00
R7698:Olfr676 UTSW 7 105035907 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCTCACCAACAGAATCATCGTTG -3'
(R):5'- GGGATGTTGTGACCAAAGCG -3'

Sequencing Primer
(F):5'- CCAACAGAATCATCGTTGTGATTGC -3'
(R):5'- CCAAAGCGGTGAGTAAGGAAG -3'
Posted On2014-10-16