Mutagenetix > Incidental Mutations

Incidental Mutation 'R2256:Fryl'

243351

Institutional Source

Beutler Lab

Gene Symbol

Fryl

Ensembl Gene

ENSMUSG00000070733

Gene Name

FRY like transcription coactivator

Synonyms

2510002A14Rik, 2310004H21Rik, 9030227G01Rik

MMRRC Submission

040256-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.767) question?

Stock #

R2256 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

73019987-73256619 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 73072844 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 1657 (N1657Y)

Ref Sequence

ENSEMBL: ENSMUSP00000098687 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094700] [ENSMUST00000101127]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000094700
AA Change: N1657Y

PolyPhen 2 Score 0.470 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000092289
Gene: ENSMUSG00000070733
AA Change: N1657Y

Domain	Start	End	E-Value	Type
Pfam:MOR2-PAG1_N	117	649	5.7e-176	PFAM
low complexity region	873	884	N/A	INTRINSIC
Pfam:MOR2-PAG1_mid	896	1141	1.3e-5	PFAM
Pfam:MOR2-PAG1_mid	1145	1331	2e-19	PFAM
Pfam:MOR2-PAG1_mid	1351	1450	1.2e-5	PFAM
low complexity region	1476	1487	N/A	INTRINSIC
low complexity region	1530	1548	N/A	INTRINSIC
Pfam:MOR2-PAG1_mid	1590	1660	1.1e-5	PFAM
Pfam:MOR2-PAG1_mid	1725	1866	3.2e-15	PFAM
low complexity region	1973	1984	N/A	INTRINSIC
Pfam:MOR2-PAG1_C	2002	2255	9.9e-78	PFAM
low complexity region	2329	2341	N/A	INTRINSIC
low complexity region	2473	2482	N/A	INTRINSIC
low complexity region	2485	2500	N/A	INTRINSIC
low complexity region	2523	2534	N/A	INTRINSIC
coiled coil region	2625	2649	N/A	INTRINSIC
low complexity region	2827	2841	N/A	INTRINSIC
coiled coil region	2854	2893	N/A	INTRINSIC
coiled coil region	2963	2989	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000101127
AA Change: N1657Y

PolyPhen 2 Score 0.470 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000098687
Gene: ENSMUSG00000070733
AA Change: N1657Y

Domain	Start	End	E-Value	Type
Pfam:MOR2-PAG1_N	116	649	3e-172	PFAM
low complexity region	873	884	N/A	INTRINSIC
Pfam:MOR2-PAG1_mid	898	1115	7.8e-6	PFAM
Pfam:MOR2-PAG1_mid	1147	1331	9.5e-19	PFAM
Pfam:MOR2-PAG1_mid	1351	1503	1.1e-5	PFAM
low complexity region	1530	1548	N/A	INTRINSIC
Pfam:MOR2-PAG1_mid	1589	1664	6e-6	PFAM
Pfam:MOR2-PAG1_mid	1725	1866	1.6e-14	PFAM
low complexity region	1973	1984	N/A	INTRINSIC
Pfam:MOR2-PAG1_C	1998	2260	4.4e-76	PFAM
low complexity region	2329	2341	N/A	INTRINSIC
low complexity region	2473	2482	N/A	INTRINSIC
low complexity region	2485	2500	N/A	INTRINSIC
low complexity region	2523	2534	N/A	INTRINSIC
coiled coil region	2625	2649	N/A	INTRINSIC
low complexity region	2827	2841	N/A	INTRINSIC
coiled coil region	2854	2893	N/A	INTRINSIC
coiled coil region	2963	2989	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156661

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175890

Predicted Effect

probably benign
Transcript: ENSMUST00000201277

Predicted Effect

unknown
Transcript: ENSMUST00000202381
AA Change: N526Y

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202413

Predicted Effect

probably benign
Transcript: ENSMUST00000202697

Meta Mutation Damage Score

0.1920

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.7%
20x: 96.3%

Validation Efficiency

98% (97/99)

MGI Phenotype

PHENOTYPE: Most mice homozygous for a knock-out allele exhibit postnatal lethality and defects in kidney development; rare survivors display growth retardation, decreased body weight, and premature death associated with chronic hydronephrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001C19Rik	AC	A	17: 47,433,423		probably benign	Het
4931409K22Rik	C	T	5: 24,552,040		probably benign	Het
6720489N17Rik	A	T	13: 62,607,396	I36N	probably benign	Het
Abcb4	T	C	5: 8,958,431	S1200P	probably damaging	Het
Acadsb	A	G	7: 131,443,653	Y438C	probably benign	Het
Acp7	A	C	7: 28,614,413	W399G	probably damaging	Het
Actr3b	A	G	5: 25,822,405	T113A	possibly damaging	Het
Adgrv1	T	C	13: 81,506,140	D2204G	probably benign	Het
Ago1	A	G	4: 126,441,911	V669A	possibly damaging	Het
Ang5	T	A	14: 43,962,521	L14Q	probably null	Het
Aoc1	T	C	6: 48,906,440	Y417H	possibly damaging	Het
Arhgap32	T	C	9: 32,247,497	I186T	probably damaging	Het
Atf2	A	T	2: 73,845,511		probably null	Het
Atg4a	A	G	X: 140,990,235	I91V	probably benign	Het
Atp7b	T	G	8: 21,998,266	T1102P	probably damaging	Het
Bend5	A	C	4: 111,431,010		probably benign	Het
Camkk2	T	C	5: 122,746,335	D341G	probably damaging	Het
Cast	T	A	13: 74,739,905	I208L	probably damaging	Het
Ccdc141	A	T	2: 77,132,262	W113R	probably damaging	Het
Cdk14	T	A	5: 4,888,924	M433L	probably benign	Het
Cel	A	G	2: 28,561,192	F51S	probably damaging	Het
Cenpc1	A	G	5: 86,016,203	L853S	probably damaging	Het
Cep162	C	A	9: 87,206,914	D972Y	probably damaging	Het
Clasrp	A	G	7: 19,586,585		probably benign	Het
Cntnap5c	T	A	17: 58,330,315	N1062K	probably benign	Het
Col3a1	A	G	1: 45,321,632	D74G	unknown	Het
Copb1	T	A	7: 114,253,875	D29V	possibly damaging	Het
Cox6a1	C	T	5: 115,348,848	E35K	possibly damaging	Het
Cyp2b9	G	A	7: 26,173,605		probably null	Het
Ddx46	A	G	13: 55,647,708	K177E	possibly damaging	Het
Dmbt1	T	C	7: 131,090,494	F823L	probably benign	Het
Drc7	A	T	8: 95,075,009	H666L	probably benign	Het
Fam228a	T	C	12: 4,737,775		probably benign	Het
Fam71e2	T	A	7: 4,771,021	M31L	probably benign	Het
Fam83e	A	T	7: 45,728,770	K406M	possibly damaging	Het
Fam83e	A	T	7: 45,728,769	K406*	probably null	Het
Fam90a1a	T	A	8: 21,963,517	L296Q	possibly damaging	Het
Fat1	A	G	8: 44,950,371	Y53C	probably damaging	Het
Fhdc1	T	C	3: 84,446,046	E624G	probably benign	Het
Fsip2	T	A	2: 82,962,751	D417E	probably benign	Het
Greb1l	A	G	18: 10,503,307	M453V	possibly damaging	Het
Gtf2b	A	G	3: 142,781,424	D207G	probably benign	Het
Has3	C	A	8: 106,874,256	L117I	probably damaging	Het
Jmjd1c	T	A	10: 67,225,294	I1142N	probably damaging	Het
Lipt2	C	T	7: 100,159,394	T38I	probably benign	Het
Magea2	A	T	X: 155,027,859	L243Q	probably damaging	Het
Mast4	A	T	13: 102,735,751	C2178S	possibly damaging	Het
Mctp2	A	G	7: 72,185,820	L543P	probably damaging	Het
Mphosph9	C	T	5: 124,283,659	V740I	probably benign	Het
Mut	A	T	17: 40,956,319	I595F	probably benign	Het
Myo1e	G	A	9: 70,378,373		probably null	Het
Nlrc4	A	G	17: 74,445,630	I586T	probably damaging	Het
Nom1	T	A	5: 29,437,752	V417D	probably damaging	Het
Nphs1	A	T	7: 30,467,992	I782F	possibly damaging	Het
Numa1	A	G	7: 102,000,791	E1243G	probably damaging	Het
Olfr1000	T	A	2: 85,608,463	Y149F	possibly damaging	Het
Olfr1254	T	C	2: 89,788,470	H294R	probably benign	Het
Olfr1290	T	C	2: 111,489,978	Y60C	probably damaging	Het
Olfr474	A	T	7: 107,955,037	Y132F	probably damaging	Het
Olfr676	A	G	7: 105,035,819	Y207C	probably benign	Het
Orai2	C	T	5: 136,161,600	V52I	probably damaging	Het
Osbpl5	A	G	7: 143,709,094	C186R	probably damaging	Het
Osbpl6	A	G	2: 76,584,474	E403G	probably damaging	Het
Padi4	G	A	4: 140,759,940	T217I	possibly damaging	Het
Parm1	C	T	5: 91,594,121	T116I	possibly damaging	Het
Pde4dip	T	A	3: 97,718,184	Q1366L	probably damaging	Het
Phgdh	T	C	3: 98,328,291	K108E	probably benign	Het
Pold1	T	C	7: 44,533,799		probably null	Het
Ppp1r37	G	T	7: 19,562,018		probably benign	Het
Sdk2	T	C	11: 113,830,794	N1332S	probably benign	Het
Sema6d	A	G	2: 124,664,150	D626G	probably damaging	Het
Skiv2l2	A	T	13: 112,876,512	M890K	probably damaging	Het
Slc18b1	A	G	10: 23,810,922	N212S	probably benign	Het
Slc2a9	T	C	5: 38,453,199	T86A	probably damaging	Het
Slco1a6	A	T	6: 142,091,016	M555K	probably benign	Het
Sntg2	C	T	12: 30,236,688	W302*	probably null	Het
Spata22	T	A	11: 73,340,475	M185K	possibly damaging	Het
Stk35	T	A	2: 129,810,507	Y309*	probably null	Het
Taar8c	A	G	10: 24,101,071	V281A	probably benign	Het
Thoc1	C	A	18: 9,993,466	D608E	possibly damaging	Het
Tmem121b	A	G	6: 120,492,071	Y562H	probably damaging	Het
Tmem121b	A	T	6: 120,492,069	Y562*	probably null	Het
Tmtc4	A	T	14: 122,941,408	I449N	probably benign	Het
Tmub1	C	A	5: 24,446,924	G14V	possibly damaging	Het
Tmub1	G	A	5: 24,447,177		probably benign	Het
Tshz2	A	G	2: 169,886,477	T529A	probably damaging	Het
Ugdh	A	T	5: 65,417,115		probably benign	Het
Usp25	A	G	16: 77,113,794	K913E	probably benign	Het
Vgf	A	G	5: 137,031,547		probably benign	Het
Vmn2r19	T	A	6: 123,329,886	F451Y	probably benign	Het
Vmn2r59	A	T	7: 42,012,245	C715*	probably null	Het
Vps9d1	C	A	8: 123,245,121	A582S	probably benign	Het
Xbp1	T	G	11: 5,524,841	H247Q	probably damaging	Het
Zfp319	A	T	8: 95,328,501	M358K	possibly damaging	Het
Zfp438	A	T	18: 5,213,508	N483K	probably damaging	Het
Zfp518b	T	C	5: 38,671,636	N1009D	possibly damaging	Het
Zfp644	A	T	5: 106,635,845	H945Q	probably damaging	Het
Zgrf1	T	A	3: 127,561,997	S291T	probably benign	Het

Other mutations in Fryl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00819:Fryl	APN	5	73148108	missense	possibly damaging	0.92
IGL01518:Fryl	APN	5	73086962	missense	possibly damaging	0.76
IGL01545:Fryl	APN	5	73054597	missense	probably damaging	1.00
IGL01646:Fryl	APN	5	73022501	critical splice donor site	probably null
IGL01938:Fryl	APN	5	73122364	missense	probably damaging	0.98
IGL01962:Fryl	APN	5	73032791	missense	possibly damaging	0.62
IGL02064:Fryl	APN	5	73124769	unclassified	probably benign
IGL02148:Fryl	APN	5	73075959	missense	probably benign	0.35
IGL02418:Fryl	APN	5	73110176	splice site	probably benign
IGL02431:Fryl	APN	5	73098308	missense	probably benign	0.02
IGL02513:Fryl	APN	5	73065293	missense	probably damaging	1.00
IGL02557:Fryl	APN	5	73098393	missense	probably damaging	1.00
IGL02625:Fryl	APN	5	73069877	intron	probably benign
IGL02642:Fryl	APN	5	73095466	missense	probably benign
IGL02657:Fryl	APN	5	73054860	missense	probably benign	0.01
IGL02706:Fryl	APN	5	73093163	missense	probably benign	0.45
IGL03022:Fryl	APN	5	73059383	missense	possibly damaging	0.82
IGL03144:Fryl	APN	5	73101455	missense	probably null	0.22
IGL03155:Fryl	APN	5	73076695	missense	probably benign
IGL03183:Fryl	APN	5	73076695	missense	probably benign
IGL03275:Fryl	APN	5	73148033	missense	possibly damaging	0.47
IGL03310:Fryl	APN	5	73136316	splice site	probably benign
IGL03341:Fryl	APN	5	73076695	missense	probably benign
IGL03343:Fryl	APN	5	73076695	missense	probably benign
IGL03350:Fryl	APN	5	73133306	missense	probably damaging	0.99
IGL03357:Fryl	APN	5	73054059	missense	probably damaging	1.00
IGL03374:Fryl	APN	5	73110281	splice site	probably benign
IGL03375:Fryl	APN	5	73088449	missense	possibly damaging	0.91
bedeviled	UTSW	5	73059500	missense	probably damaging	1.00
Besotted	UTSW	5	73072912	missense	probably damaging	1.00
R0062:Fryl	UTSW	5	73022278	missense	probably benign	0.02
R0062:Fryl	UTSW	5	73022278	missense	probably benign	0.02
R0308:Fryl	UTSW	5	73041604	splice site	probably benign
R0312:Fryl	UTSW	5	73072888	missense	probably damaging	1.00
R0415:Fryl	UTSW	5	73098414	missense	probably damaging	0.99
R0440:Fryl	UTSW	5	73086972	missense	possibly damaging	0.91
R0446:Fryl	UTSW	5	73097417	missense	possibly damaging	0.91
R0566:Fryl	UTSW	5	73064497	splice site	probably benign
R0567:Fryl	UTSW	5	73065391	missense	possibly damaging	0.50
R0606:Fryl	UTSW	5	73124734	missense	probably benign	0.15
R0619:Fryl	UTSW	5	73068731	missense	probably benign	0.22
R0654:Fryl	UTSW	5	73083372	missense	probably benign	0.17
R0658:Fryl	UTSW	5	73065359	missense	probably damaging	1.00
R0707:Fryl	UTSW	5	73083372	missense	probably benign	0.17
R0744:Fryl	UTSW	5	73089081	unclassified	probably benign
R0745:Fryl	UTSW	5	73071126	missense	probably damaging	0.96
R0833:Fryl	UTSW	5	73089081	unclassified	probably benign
R0885:Fryl	UTSW	5	73089196	missense	probably damaging	0.97
R0894:Fryl	UTSW	5	73041332	splice site	probably benign
R1076:Fryl	UTSW	5	73124673	unclassified	probably benign
R1241:Fryl	UTSW	5	73064925	splice site	probably benign
R1241:Fryl	UTSW	5	73110271	missense	probably damaging	1.00
R1394:Fryl	UTSW	5	73072912	missense	probably damaging	1.00
R1395:Fryl	UTSW	5	73072912	missense	probably damaging	1.00
R1608:Fryl	UTSW	5	73074751	nonsense	probably null
R1664:Fryl	UTSW	5	73059435	missense	probably damaging	1.00
R1745:Fryl	UTSW	5	73032861	splice site	probably benign
R1937:Fryl	UTSW	5	73133367	missense	probably damaging	1.00
R1969:Fryl	UTSW	5	73098266	missense	probably benign	0.18
R1993:Fryl	UTSW	5	73108493	missense	probably damaging	1.00
R1994:Fryl	UTSW	5	73108493	missense	probably damaging	1.00
R2029:Fryl	UTSW	5	73022122	nonsense	probably null
R2036:Fryl	UTSW	5	73022544	missense	probably benign
R2036:Fryl	UTSW	5	73107962	critical splice donor site	probably null
R2088:Fryl	UTSW	5	73065461	missense	probably benign	0.02
R2105:Fryl	UTSW	5	73122299	missense	probably benign
R2106:Fryl	UTSW	5	73098331	missense	probably damaging	1.00
R2186:Fryl	UTSW	5	73064975	missense	probably damaging	1.00
R2239:Fryl	UTSW	5	73108547	missense	probably damaging	0.99
R2257:Fryl	UTSW	5	73072844	missense	possibly damaging	0.47
R2280:Fryl	UTSW	5	73041364	missense	possibly damaging	0.47
R2281:Fryl	UTSW	5	73041364	missense	possibly damaging	0.47
R2911:Fryl	UTSW	5	73050456	missense	probably damaging	0.99
R3019:Fryl	UTSW	5	73082850	missense	probably benign	0.01
R3416:Fryl	UTSW	5	73108074	missense	possibly damaging	0.84
R3783:Fryl	UTSW	5	73101476	missense	probably benign
R3787:Fryl	UTSW	5	73101476	missense	probably benign
R3837:Fryl	UTSW	5	73071265	missense	probably benign	0.03
R3969:Fryl	UTSW	5	73112423	missense	probably damaging	0.97
R4387:Fryl	UTSW	5	73086560	missense	possibly damaging	0.91
R4502:Fryl	UTSW	5	73088397	missense	probably damaging	1.00
R4658:Fryl	UTSW	5	73081053	missense	probably damaging	1.00
R4664:Fryl	UTSW	5	73090679	missense	possibly damaging	0.80
R4690:Fryl	UTSW	5	73100293	missense	probably benign
R4700:Fryl	UTSW	5	73065538	missense	possibly damaging	0.88
R4709:Fryl	UTSW	5	73080972	missense	probably benign	0.03
R4807:Fryl	UTSW	5	73041362	missense	probably benign	0.00
R4912:Fryl	UTSW	5	73068782	frame shift	probably null
R4948:Fryl	UTSW	5	73089130	missense	probably benign	0.08
R4959:Fryl	UTSW	5	73035058	missense	probably benign	0.00
R5062:Fryl	UTSW	5	73075893	missense	possibly damaging	0.89
R5067:Fryl	UTSW	5	73057755	missense	probably benign	0.13
R5071:Fryl	UTSW	5	73074767	missense	probably damaging	0.99
R5072:Fryl	UTSW	5	73074767	missense	probably damaging	0.99
R5073:Fryl	UTSW	5	73074767	missense	probably damaging	0.99
R5074:Fryl	UTSW	5	73074767	missense	probably damaging	0.99
R5139:Fryl	UTSW	5	73090718	missense	probably damaging	1.00
R5172:Fryl	UTSW	5	73101673	missense	possibly damaging	0.95
R5187:Fryl	UTSW	5	73086600	missense	possibly damaging	0.95
R5272:Fryl	UTSW	5	73065136	nonsense	probably null
R5275:Fryl	UTSW	5	73112791	missense	probably damaging	1.00
R5295:Fryl	UTSW	5	73112791	missense	probably damaging	1.00
R5344:Fryl	UTSW	5	73104774	missense	probably damaging	1.00
R5355:Fryl	UTSW	5	73073904	missense	probably damaging	1.00
R5716:Fryl	UTSW	5	73100465	missense	probably benign
R5778:Fryl	UTSW	5	73072778	missense	probably damaging	1.00
R5810:Fryl	UTSW	5	73090755	missense	probably benign	0.06
R5934:Fryl	UTSW	5	73090717	missense	probably damaging	1.00
R5948:Fryl	UTSW	5	73097372	critical splice donor site	probably null
R6005:Fryl	UTSW	5	73083295	missense	probably damaging	1.00
R6026:Fryl	UTSW	5	73099997	missense	probably benign	0.04
R6045:Fryl	UTSW	5	73118551	missense	probably damaging	0.99
R6185:Fryl	UTSW	5	73112788	missense	probably benign	0.43
R6247:Fryl	UTSW	5	73065481	missense	probably damaging	0.98
R6294:Fryl	UTSW	5	73191759	intron	probably benign
R6310:Fryl	UTSW	5	73191761	intron	probably benign
R6429:Fryl	UTSW	5	73090751	missense	possibly damaging	0.84
R6568:Fryl	UTSW	5	73059516	missense	probably damaging	1.00
R6636:Fryl	UTSW	5	73133312	missense	probably benign	0.01
R6664:Fryl	UTSW	5	73132481	missense	probably damaging	1.00
R6732:Fryl	UTSW	5	73054781	missense	probably damaging	1.00
R6750:Fryl	UTSW	5	73022232	missense	probably damaging	1.00
R6805:Fryl	UTSW	5	73065094	missense	probably benign	0.03
R6823:Fryl	UTSW	5	73065217	missense	probably damaging	0.99
R6855:Fryl	UTSW	5	73059500	missense	probably damaging	1.00
R6858:Fryl	UTSW	5	73065032	missense	probably damaging	1.00
R6868:Fryl	UTSW	5	73068803	missense	probably damaging	1.00
R6898:Fryl	UTSW	5	73022142	missense	probably damaging	0.96
R6908:Fryl	UTSW	5	73022211	missense	probably damaging	1.00
R6958:Fryl	UTSW	5	73073929	missense	possibly damaging	0.89
R6980:Fryl	UTSW	5	73050430	missense	probably benign	0.06
R7036:Fryl	UTSW	5	73055608	missense	probably benign	0.03
R7065:Fryl	UTSW	5	73090756	missense	probably damaging	0.96
R7097:Fryl	UTSW	5	73073908	missense	probably benign	0.31
R7171:Fryl	UTSW	5	73122310	missense	probably damaging	0.97
R7191:Fryl	UTSW	5	73072912	missense	probably damaging	1.00
R7207:Fryl	UTSW	5	73065095	missense	probably benign
R7236:Fryl	UTSW	5	73108478	missense	possibly damaging	0.66
R7334:Fryl	UTSW	5	73047496	splice site	probably null
R7425:Fryl	UTSW	5	73104748	missense	probably damaging	1.00
R7452:Fryl	UTSW	5	73023988	missense	probably damaging	1.00
R7479:Fryl	UTSW	5	73097561	missense	possibly damaging	0.71
R7535:Fryl	UTSW	5	73098196	missense	probably benign	0.15
R7538:Fryl	UTSW	5	73022676	missense	probably benign	0.09
R7544:Fryl	UTSW	5	73081039	missense	probably benign
R7548:Fryl	UTSW	5	73191762	missense	unknown
R7565:Fryl	UTSW	5	73033720	missense	probably benign	0.18
R7572:Fryl	UTSW	5	73088396	missense	possibly damaging	0.91
R7582:Fryl	UTSW	5	73022500	critical splice donor site	probably null
R7630:Fryl	UTSW	5	73110245	missense	possibly damaging	0.62
R7774:Fryl	UTSW	5	73083384	missense	probably benign	0.12
R7777:Fryl	UTSW	5	73071298	missense	probably damaging	0.98
R7917:Fryl	UTSW	5	73054532	missense	probably damaging	1.00
R7920:Fryl	UTSW	5	73101807	splice site	probably null
R8110:Fryl	UTSW	5	73133277	missense	probably benign	0.10
R8120:Fryl	UTSW	5	73071184	missense	probably benign	0.01
R8143:Fryl	UTSW	5	73050339	missense	probably benign	0.00
R8207:Fryl	UTSW	5	73100500	splice site	probably null
R8263:Fryl	UTSW	5	73081005	missense	probably damaging	1.00
R8350:Fryl	UTSW	5	73068730	missense	probably benign
R8359:Fryl	UTSW	5	73075933	missense	probably benign	0.39
R8387:Fryl	UTSW	5	73136320	critical splice donor site	probably null
R8403:Fryl	UTSW	5	73118447	makesense	probably null
R8450:Fryl	UTSW	5	73068730	missense	probably benign
R8514:Fryl	UTSW	5	73085356	missense	probably benign
R8536:Fryl	UTSW	5	73100353	missense	probably damaging	0.99
R8703:Fryl	UTSW	5	73090654	missense	probably damaging	0.99
R8708:Fryl	UTSW	5	73132562	missense	probably benign	0.01
R8783:Fryl	UTSW	5	73068842	missense	probably benign	0.45
R9028:Fryl	UTSW	5	73098266	missense	probably benign	0.18
R9045:Fryl	UTSW	5	73024775	missense
R9063:Fryl	UTSW	5	73081003	missense	possibly damaging	0.70
R9096:Fryl	UTSW	5	73108577	missense	probably benign	0.01
R9345:Fryl	UTSW	5	73050411	missense	probably benign
R9381:Fryl	UTSW	5	73083294	missense	probably benign	0.24
R9386:Fryl	UTSW	5	73191809	missense	unknown
R9401:Fryl	UTSW	5	73065220	nonsense	probably null
Z1088:Fryl	UTSW	5	73090709	missense	probably damaging	0.99
Z1088:Fryl	UTSW	5	73090738	missense	probably damaging	1.00
Z1176:Fryl	UTSW	5	73072837	missense	probably benign
Z1177:Fryl	UTSW	5	73041595	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CGCTACTTGAAATGATACAACTGC -3'
(R):5'- TTGCACGTCAGGAAGCTGTG -3'

Sequencing Primer
(F):5'- CTGCATCTGAAATGTTTACGCAG -3'
(R):5'- CGTCAGGAAGCTGTGTGCAG -3'

Posted On

2014-10-16