Mutagenetix > Incidental Mutations

Incidental Mutation 'R2256:Mast4'

243407

Institutional Source

Beutler Lab

Gene Symbol

Mast4

Ensembl Gene

ENSMUSG00000034751

Gene Name

microtubule associated serine/threonine kinase family member 4

Synonyms

4930420O11Rik

MMRRC Submission

040256-MU

Accession Numbers

Genbank: NM_175171.3; EnsemblENSMUST00000167058 , ENSMUST00000167462, ENSMUST00000166726, ENSMUST00000164111 , ENSMUST00000166336, ENSMUST00000099202, ENSMUST00000172264, ENSMUST00000171791, ENSMUST00000091273

Is this an essential gene?

Possibly non essential (E-score: 0.449) question?

Stock #

R2256 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102732486-103334497 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 102735751 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 2178 (C2178S)

Ref Sequence

ENSEMBL: ENSMUSP00000131651 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099202] [ENSMUST00000166726] [ENSMUST00000167058] [ENSMUST00000170878] [ENSMUST00000171791] [ENSMUST00000172138]

Predicted Effect

probably benign
Transcript: ENSMUST00000099202
AA Change: C2193S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000096808
Gene: ENSMUSG00000034751
AA Change: C2193S

Domain	Start	End	E-Value	Type
low complexity region	13	38	N/A	INTRINSIC
Pfam:DUF1908	76	353	2.2e-146	PFAM
S_TKc	391	664	4.13e-98	SMART
S_TK_X	665	729	3.79e-2	SMART
low complexity region	745	758	N/A	INTRINSIC
low complexity region	818	831	N/A	INTRINSIC
low complexity region	840	857	N/A	INTRINSIC
low complexity region	925	960	N/A	INTRINSIC
PDZ	970	1050	2.34e-15	SMART
low complexity region	1070	1087	N/A	INTRINSIC
low complexity region	1111	1122	N/A	INTRINSIC
low complexity region	1127	1139	N/A	INTRINSIC
low complexity region	1142	1164	N/A	INTRINSIC
low complexity region	1202	1219	N/A	INTRINSIC
low complexity region	1290	1306	N/A	INTRINSIC
low complexity region	1345	1361	N/A	INTRINSIC
low complexity region	1937	1953	N/A	INTRINSIC
low complexity region	1996	2010	N/A	INTRINSIC
low complexity region	2150	2161	N/A	INTRINSIC
low complexity region	2296	2307	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000166726

SMART Domains

Protein: ENSMUSP00000132263
Gene: ENSMUSG00000034751

Domain	Start	End	E-Value	Type
low complexity region	23	51	N/A	INTRINSIC
Pfam:DUF1908	256	530	4.2e-145	PFAM
S_TKc	568	841	4.13e-98	SMART
S_TK_X	842	906	3.79e-2	SMART
low complexity region	922	935	N/A	INTRINSIC
low complexity region	995	1008	N/A	INTRINSIC
low complexity region	1035	1070	N/A	INTRINSIC
PDZ	1080	1160	2.34e-15	SMART
low complexity region	1180	1201	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167058
AA Change: C2370S

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000128464
Gene: ENSMUSG00000034751
AA Change: C2370S

Domain	Start	End	E-Value	Type
low complexity region	23	51	N/A	INTRINSIC
Pfam:DUF1908	256	529	5.1e-134	PFAM
S_TKc	568	841	4.13e-98	SMART
S_TK_X	842	906	3.79e-2	SMART
low complexity region	922	935	N/A	INTRINSIC
low complexity region	995	1008	N/A	INTRINSIC
low complexity region	1017	1034	N/A	INTRINSIC
low complexity region	1102	1137	N/A	INTRINSIC
PDZ	1147	1227	2.34e-15	SMART
low complexity region	1247	1264	N/A	INTRINSIC
low complexity region	1288	1299	N/A	INTRINSIC
low complexity region	1304	1316	N/A	INTRINSIC
low complexity region	1319	1341	N/A	INTRINSIC
low complexity region	1379	1396	N/A	INTRINSIC
low complexity region	1467	1483	N/A	INTRINSIC
low complexity region	1522	1538	N/A	INTRINSIC
low complexity region	2114	2130	N/A	INTRINSIC
low complexity region	2173	2187	N/A	INTRINSIC
low complexity region	2327	2338	N/A	INTRINSIC
low complexity region	2473	2484	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170878

SMART Domains

Protein: ENSMUSP00000127880
Gene: ENSMUSG00000021624

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
PDB:3T6Q\|B	21	86	3e-38	PDB
SCOP:d1m0za_	35	84	4e-4	SMART
Blast:LRR	51	75	1e-5	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000171791
AA Change: C2178S

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000131651
Gene: ENSMUSG00000034751
AA Change: C2178S

Domain	Start	End	E-Value	Type
Pfam:DUF1908	64	338	1.2e-144	PFAM
S_TKc	376	649	4.13e-98	SMART
S_TK_X	650	714	3.79e-2	SMART
low complexity region	730	743	N/A	INTRINSIC
low complexity region	803	816	N/A	INTRINSIC
low complexity region	825	842	N/A	INTRINSIC
low complexity region	910	945	N/A	INTRINSIC
PDZ	955	1035	2.34e-15	SMART
low complexity region	1055	1072	N/A	INTRINSIC
low complexity region	1096	1107	N/A	INTRINSIC
low complexity region	1112	1124	N/A	INTRINSIC
low complexity region	1127	1149	N/A	INTRINSIC
low complexity region	1187	1204	N/A	INTRINSIC
low complexity region	1275	1291	N/A	INTRINSIC
low complexity region	1330	1346	N/A	INTRINSIC
low complexity region	1922	1938	N/A	INTRINSIC
low complexity region	1981	1995	N/A	INTRINSIC
low complexity region	2135	2146	N/A	INTRINSIC
low complexity region	2281	2292	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172138

Predicted Effect

unknown
Transcript: ENSMUST00000194446
AA Change: C2202S

Meta Mutation Damage Score

0.0622

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.7%
20x: 96.3%

Validation Efficiency

98% (97/99)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule-associated serine/threonine protein kinases. The proteins in this family contain a domain that gives the kinase the ability to determine its own scaffold to control the effects of their kinase activities. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit malocclusion. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001C19Rik	AC	A	17: 47,433,423		probably benign	Het
4931409K22Rik	C	T	5: 24,552,040		probably benign	Het
6720489N17Rik	A	T	13: 62,607,396	I36N	probably benign	Het
Abcb4	T	C	5: 8,958,431	S1200P	probably damaging	Het
Acadsb	A	G	7: 131,443,653	Y438C	probably benign	Het
Acp7	A	C	7: 28,614,413	W399G	probably damaging	Het
Actr3b	A	G	5: 25,822,405	T113A	possibly damaging	Het
Adgrv1	T	C	13: 81,506,140	D2204G	probably benign	Het
Ago1	A	G	4: 126,441,911	V669A	possibly damaging	Het
Ang5	T	A	14: 43,962,521	L14Q	probably null	Het
Aoc1	T	C	6: 48,906,440	Y417H	possibly damaging	Het
Arhgap32	T	C	9: 32,247,497	I186T	probably damaging	Het
Atf2	A	T	2: 73,845,511		probably null	Het
Atg4a	A	G	X: 140,990,235	I91V	probably benign	Het
Atp7b	T	G	8: 21,998,266	T1102P	probably damaging	Het
Bend5	A	C	4: 111,431,010		probably benign	Het
Camkk2	T	C	5: 122,746,335	D341G	probably damaging	Het
Cast	T	A	13: 74,739,905	I208L	probably damaging	Het
Ccdc141	A	T	2: 77,132,262	W113R	probably damaging	Het
Cdk14	T	A	5: 4,888,924	M433L	probably benign	Het
Cel	A	G	2: 28,561,192	F51S	probably damaging	Het
Cenpc1	A	G	5: 86,016,203	L853S	probably damaging	Het
Cep162	C	A	9: 87,206,914	D972Y	probably damaging	Het
Clasrp	A	G	7: 19,586,585		probably benign	Het
Cntnap5c	T	A	17: 58,330,315	N1062K	probably benign	Het
Col3a1	A	G	1: 45,321,632	D74G	unknown	Het
Copb1	T	A	7: 114,253,875	D29V	possibly damaging	Het
Cox6a1	C	T	5: 115,348,848	E35K	possibly damaging	Het
Cyp2b9	G	A	7: 26,173,605		probably null	Het
Ddx46	A	G	13: 55,647,708	K177E	possibly damaging	Het
Dmbt1	T	C	7: 131,090,494	F823L	probably benign	Het
Drc7	A	T	8: 95,075,009	H666L	probably benign	Het
Fam228a	T	C	12: 4,737,775		probably benign	Het
Fam71e2	T	A	7: 4,771,021	M31L	probably benign	Het
Fam83e	A	T	7: 45,728,769	K406*	probably null	Het
Fam83e	A	T	7: 45,728,770	K406M	possibly damaging	Het
Fam90a1a	T	A	8: 21,963,517	L296Q	possibly damaging	Het
Fat1	A	G	8: 44,950,371	Y53C	probably damaging	Het
Fhdc1	T	C	3: 84,446,046	E624G	probably benign	Het
Fryl	T	A	5: 73,072,844	N1657Y	possibly damaging	Het
Fsip2	T	A	2: 82,962,751	D417E	probably benign	Het
Greb1l	A	G	18: 10,503,307	M453V	possibly damaging	Het
Gtf2b	A	G	3: 142,781,424	D207G	probably benign	Het
Has3	C	A	8: 106,874,256	L117I	probably damaging	Het
Jmjd1c	T	A	10: 67,225,294	I1142N	probably damaging	Het
Lipt2	C	T	7: 100,159,394	T38I	probably benign	Het
Magea2	A	T	X: 155,027,859	L243Q	probably damaging	Het
Mctp2	A	G	7: 72,185,820	L543P	probably damaging	Het
Mphosph9	C	T	5: 124,283,659	V740I	probably benign	Het
Mut	A	T	17: 40,956,319	I595F	probably benign	Het
Myo1e	G	A	9: 70,378,373		probably null	Het
Nlrc4	A	G	17: 74,445,630	I586T	probably damaging	Het
Nom1	T	A	5: 29,437,752	V417D	probably damaging	Het
Nphs1	A	T	7: 30,467,992	I782F	possibly damaging	Het
Numa1	A	G	7: 102,000,791	E1243G	probably damaging	Het
Olfr1000	T	A	2: 85,608,463	Y149F	possibly damaging	Het
Olfr1254	T	C	2: 89,788,470	H294R	probably benign	Het
Olfr1290	T	C	2: 111,489,978	Y60C	probably damaging	Het
Olfr474	A	T	7: 107,955,037	Y132F	probably damaging	Het
Olfr676	A	G	7: 105,035,819	Y207C	probably benign	Het
Orai2	C	T	5: 136,161,600	V52I	probably damaging	Het
Osbpl5	A	G	7: 143,709,094	C186R	probably damaging	Het
Osbpl6	A	G	2: 76,584,474	E403G	probably damaging	Het
Padi4	G	A	4: 140,759,940	T217I	possibly damaging	Het
Parm1	C	T	5: 91,594,121	T116I	possibly damaging	Het
Pde4dip	T	A	3: 97,718,184	Q1366L	probably damaging	Het
Phgdh	T	C	3: 98,328,291	K108E	probably benign	Het
Pold1	T	C	7: 44,533,799		probably null	Het
Ppp1r37	G	T	7: 19,562,018		probably benign	Het
Sdk2	T	C	11: 113,830,794	N1332S	probably benign	Het
Sema6d	A	G	2: 124,664,150	D626G	probably damaging	Het
Skiv2l2	A	T	13: 112,876,512	M890K	probably damaging	Het
Slc18b1	A	G	10: 23,810,922	N212S	probably benign	Het
Slc2a9	T	C	5: 38,453,199	T86A	probably damaging	Het
Slco1a6	A	T	6: 142,091,016	M555K	probably benign	Het
Sntg2	C	T	12: 30,236,688	W302*	probably null	Het
Spata22	T	A	11: 73,340,475	M185K	possibly damaging	Het
Stk35	T	A	2: 129,810,507	Y309*	probably null	Het
Taar8c	A	G	10: 24,101,071	V281A	probably benign	Het
Thoc1	C	A	18: 9,993,466	D608E	possibly damaging	Het
Tmem121b	A	T	6: 120,492,069	Y562*	probably null	Het
Tmem121b	A	G	6: 120,492,071	Y562H	probably damaging	Het
Tmtc4	A	T	14: 122,941,408	I449N	probably benign	Het
Tmub1	C	A	5: 24,446,924	G14V	possibly damaging	Het
Tmub1	G	A	5: 24,447,177		probably benign	Het
Tshz2	A	G	2: 169,886,477	T529A	probably damaging	Het
Ugdh	A	T	5: 65,417,115		probably benign	Het
Usp25	A	G	16: 77,113,794	K913E	probably benign	Het
Vgf	A	G	5: 137,031,547		probably benign	Het
Vmn2r19	T	A	6: 123,329,886	F451Y	probably benign	Het
Vmn2r59	A	T	7: 42,012,245	C715*	probably null	Het
Vps9d1	C	A	8: 123,245,121	A582S	probably benign	Het
Xbp1	T	G	11: 5,524,841	H247Q	probably damaging	Het
Zfp319	A	T	8: 95,328,501	M358K	possibly damaging	Het
Zfp438	A	T	18: 5,213,508	N483K	probably damaging	Het
Zfp518b	T	C	5: 38,671,636	N1009D	possibly damaging	Het
Zfp644	A	T	5: 106,635,845	H945Q	probably damaging	Het
Zgrf1	T	A	3: 127,561,997	S291T	probably benign	Het

Other mutations in Mast4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00703:Mast4	APN	13	102770767	nonsense	probably null
IGL00933:Mast4	APN	13	102735366	missense	probably damaging	0.97
IGL01113:Mast4	APN	13	102774236	missense	probably damaging	1.00
IGL01461:Mast4	APN	13	102754068	missense	probably damaging	1.00
IGL01569:Mast4	APN	13	102761015	missense	probably damaging	1.00
IGL01697:Mast4	APN	13	102767893	missense	probably damaging	1.00
IGL01725:Mast4	APN	13	102750512	critical splice donor site	probably null
IGL01734:Mast4	APN	13	102737615	missense	probably damaging	0.98
IGL01738:Mast4	APN	13	102737241	missense	probably damaging	1.00
IGL01739:Mast4	APN	13	102774273	missense	probably damaging	1.00
IGL02299:Mast4	APN	13	102737974	missense	probably benign	0.44
IGL02479:Mast4	APN	13	102742037	missense	probably damaging	1.00
IGL02485:Mast4	APN	13	102735496	missense	probably benign	0.02
IGL02528:Mast4	APN	13	102853823	makesense	probably null
IGL02850:Mast4	APN	13	102754232	missense	probably damaging	1.00
IGL02900:Mast4	APN	13	102735676	missense	probably benign
IGL03064:Mast4	APN	13	102760964	nonsense	probably null
IGL03124:Mast4	APN	13	102738245	missense	probably damaging	1.00
IGL03146:Mast4	APN	13	102737655	missense	probably benign	0.00
IGL03221:Mast4	APN	13	102754256	missense	possibly damaging	0.95
IGL03284:Mast4	APN	13	102751397	missense	probably damaging	1.00
IGL03406:Mast4	APN	13	102737107	missense	possibly damaging	0.46
buck	UTSW	13	102761293	critical splice donor site	probably null
doe	UTSW	13	102905677	missense	possibly damaging	0.85
FR4304:Mast4	UTSW	13	102734862	utr 3 prime	probably benign
FR4340:Mast4	UTSW	13	102734857	frame shift	probably null
FR4340:Mast4	UTSW	13	102736317	small insertion	probably benign
FR4548:Mast4	UTSW	13	102736318	small insertion	probably benign
FR4976:Mast4	UTSW	13	102736312	small insertion	probably benign
FR4976:Mast4	UTSW	13	102739247	frame shift	probably null
NA:Mast4	UTSW	13	102742057	missense	probably damaging	1.00
PIT4466001:Mast4	UTSW	13	102804718	missense	probably damaging	1.00
PIT4469001:Mast4	UTSW	13	102804718	missense	probably damaging	1.00
PIT4472001:Mast4	UTSW	13	102804718	missense	probably damaging	1.00
R0009:Mast4	UTSW	13	102742058	missense	probably damaging	1.00
R0063:Mast4	UTSW	13	103334215	start gained	probably benign
R0242:Mast4	UTSW	13	102853842	missense	probably damaging	1.00
R0310:Mast4	UTSW	13	102754161	missense	possibly damaging	0.94
R0395:Mast4	UTSW	13	102735273	missense	probably damaging	1.00
R0454:Mast4	UTSW	13	102751560	missense	probably damaging	1.00
R0646:Mast4	UTSW	13	102758744	splice site	probably benign
R0744:Mast4	UTSW	13	102737387	missense	probably damaging	0.98
R0883:Mast4	UTSW	13	102853900	missense	probably damaging	1.00
R0905:Mast4	UTSW	13	102770784	missense	probably damaging	0.99
R1023:Mast4	UTSW	13	102735496	missense	probably benign	0.02
R1281:Mast4	UTSW	13	102750578	missense	probably damaging	1.00
R1376:Mast4	UTSW	13	102736408	missense	possibly damaging	0.46
R1376:Mast4	UTSW	13	102736408	missense	possibly damaging	0.46
R1473:Mast4	UTSW	13	102772519	missense	probably damaging	1.00
R1572:Mast4	UTSW	13	102736923	missense	possibly damaging	0.51
R1575:Mast4	UTSW	13	102739263	missense	probably damaging	1.00
R1865:Mast4	UTSW	13	102794117	missense	probably damaging	1.00
R2050:Mast4	UTSW	13	102751409	missense	probably damaging	1.00
R2060:Mast4	UTSW	13	102738846	missense	probably damaging	1.00
R2062:Mast4	UTSW	13	102759093	missense	probably benign	0.18
R2106:Mast4	UTSW	13	102750546	missense	probably damaging	1.00
R2118:Mast4	UTSW	13	102754205	missense	probably damaging	1.00
R2143:Mast4	UTSW	13	102735475	missense	possibly damaging	0.89
R2261:Mast4	UTSW	13	102798207	splice site	probably benign
R2370:Mast4	UTSW	13	102774187	missense	probably damaging	1.00
R2504:Mast4	UTSW	13	102738639	missense	probably damaging	0.96
R2509:Mast4	UTSW	13	102853842	missense	probably damaging	1.00
R2842:Mast4	UTSW	13	102736431	missense	probably benign	0.01
R3087:Mast4	UTSW	13	102853926	splice site	probably benign
R3434:Mast4	UTSW	13	102787379	missense	probably damaging	1.00
R3435:Mast4	UTSW	13	102787379	missense	probably damaging	1.00
R3763:Mast4	UTSW	13	102787419	missense	probably damaging	1.00
R3826:Mast4	UTSW	13	102738811	missense	probably damaging	1.00
R3829:Mast4	UTSW	13	102738811	missense	probably damaging	1.00
R3830:Mast4	UTSW	13	102738811	missense	probably damaging	1.00
R3913:Mast4	UTSW	13	102758669	missense	probably damaging	1.00
R3914:Mast4	UTSW	13	102739321	nonsense	probably null
R4021:Mast4	UTSW	13	102739321	nonsense	probably null
R4022:Mast4	UTSW	13	102739321	nonsense	probably null
R4022:Mast4	UTSW	13	102853869	missense	probably damaging	1.00
R4210:Mast4	UTSW	13	102739205	missense	probably damaging	1.00
R4342:Mast4	UTSW	13	102774248	missense	probably damaging	1.00
R4580:Mast4	UTSW	13	102737258	nonsense	probably null
R4627:Mast4	UTSW	13	103334021	missense	possibly damaging	0.92
R4711:Mast4	UTSW	13	103334119	missense	probably benign	0.01
R4732:Mast4	UTSW	13	102772572	missense	probably damaging	0.99
R4733:Mast4	UTSW	13	102772572	missense	probably damaging	0.99
R4833:Mast4	UTSW	13	102774184	critical splice donor site	probably null
R4995:Mast4	UTSW	13	102905754	intron	probably benign
R5059:Mast4	UTSW	13	102750563	missense	probably damaging	1.00
R5073:Mast4	UTSW	13	102738883	nonsense	probably null
R5101:Mast4	UTSW	13	102736356	missense	probably benign	0.01
R5526:Mast4	UTSW	13	102754215	missense	possibly damaging	0.48
R5599:Mast4	UTSW	13	102737479	missense	probably damaging	1.00
R5673:Mast4	UTSW	13	102794072	missense	probably damaging	1.00
R5694:Mast4	UTSW	13	102774193	nonsense	probably null
R5906:Mast4	UTSW	13	102735744	missense	probably benign	0.31
R5908:Mast4	UTSW	13	102738256	missense	probably damaging	1.00
R5947:Mast4	UTSW	13	102735640	missense	probably benign
R5987:Mast4	UTSW	13	102758734	missense	probably damaging	1.00
R6143:Mast4	UTSW	13	102853883	missense	probably damaging	1.00
R6154:Mast4	UTSW	13	102787421	missense	probably damaging	1.00
R6169:Mast4	UTSW	13	102787421	missense	probably damaging	1.00
R6239:Mast4	UTSW	13	102736209	missense	probably benign	0.01
R6327:Mast4	UTSW	13	102761382	missense	probably damaging	1.00
R6356:Mast4	UTSW	13	102735985	missense	possibly damaging	0.80
R6432:Mast4	UTSW	13	102905677	missense	possibly damaging	0.85
R6522:Mast4	UTSW	13	102761293	critical splice donor site	probably null
R6667:Mast4	UTSW	13	102737496	missense	probably damaging	1.00
R6941:Mast4	UTSW	13	102804714	missense	probably damaging	1.00
R6968:Mast4	UTSW	13	102798078	missense	probably damaging	1.00
R6968:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6970:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6980:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6991:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6992:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6993:Mast4	UTSW	13	102735974	missense	probably benign	0.28
R6993:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R7083:Mast4	UTSW	13	102737715	missense	probably damaging	1.00
R7241:Mast4	UTSW	13	103334000	missense	possibly damaging	0.87
R7242:Mast4	UTSW	13	102738478	missense	probably damaging	1.00
R7246:Mast4	UTSW	13	102794003	missense	probably damaging	1.00
R7332:Mast4	UTSW	13	102751424	missense	possibly damaging	0.61
R7453:Mast4	UTSW	13	102804641	critical splice donor site	probably null
R7514:Mast4	UTSW	13	102787426	nonsense	probably null
R7697:Mast4	UTSW	13	102739203	missense	probably damaging	1.00
R7820:Mast4	UTSW	13	102754088	missense	probably damaging	1.00
R7874:Mast4	UTSW	13	102739275	missense	probably damaging	1.00
R7957:Mast4	UTSW	13	102739275	missense	probably damaging	1.00
R8042:Mast4	UTSW	13	102781245	missense	probably damaging	0.96
R8060:Mast4	UTSW	13	102737676	missense	possibly damaging	0.89
RF005:Mast4	UTSW	13	102736307	small insertion	probably benign
RF015:Mast4	UTSW	13	102739247	frame shift	probably null
RF019:Mast4	UTSW	13	102736307	small insertion	probably benign
RF037:Mast4	UTSW	13	102739241	small deletion	probably benign
RF039:Mast4	UTSW	13	102739241	small deletion	probably benign
RF040:Mast4	UTSW	13	102739241	small deletion	probably benign
Z1088:Mast4	UTSW	13	102738519	missense	probably damaging	1.00
Z1176:Mast4	UTSW	13	102738460	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTTTCAGCCAGTGACTTCTG -3'
(R):5'- GTCCTCTCGATGCCAAACTG -3'

Sequencing Primer
(F):5'- GGCTCAGAGAAGCCCTT -3'
(R):5'- ACCAATGGAGGGTGTCCC -3'

Posted On

2014-10-16