Mutagenetix > Incidental Mutations

Incidental Mutation 'R2256:Mast4'

243407

Institutional Source

Beutler Lab

Gene Symbol

Mast4

Ensembl Gene

ENSMUSG00000034751

Gene Name

microtubule associated serine/threonine kinase family member 4

Synonyms

4930420O11Rik

MMRRC Submission

040256-MU

Accession Numbers

Genbank: NM_175171.3; EnsemblENSMUST00000167058 , ENSMUST00000167462, ENSMUST00000166726, ENSMUST00000164111 , ENSMUST00000166336, ENSMUST00000099202, ENSMUST00000172264, ENSMUST00000171791, ENSMUST00000091273

Is this an essential gene?

Possibly non essential (E-score: 0.320) question?

Stock #

R2256 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102732486-103334497 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 102735751 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 2178 (C2178S)

Ref Sequence

ENSEMBL: ENSMUSP00000131651 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099202] [ENSMUST00000166726] [ENSMUST00000167058] [ENSMUST00000170878] [ENSMUST00000171791] [ENSMUST00000172138]

Predicted Effect

probably benign
Transcript: ENSMUST00000099202
AA Change: C2193S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000096808
Gene: ENSMUSG00000034751
AA Change: C2193S

Domain	Start	End	E-Value	Type
low complexity region	13	38	N/A	INTRINSIC
Pfam:DUF1908	76	353	2.2e-146	PFAM
S_TKc	391	664	4.13e-98	SMART
S_TK_X	665	729	3.79e-2	SMART
low complexity region	745	758	N/A	INTRINSIC
low complexity region	818	831	N/A	INTRINSIC
low complexity region	840	857	N/A	INTRINSIC
low complexity region	925	960	N/A	INTRINSIC
PDZ	970	1050	2.34e-15	SMART
low complexity region	1070	1087	N/A	INTRINSIC
low complexity region	1111	1122	N/A	INTRINSIC
low complexity region	1127	1139	N/A	INTRINSIC
low complexity region	1142	1164	N/A	INTRINSIC
low complexity region	1202	1219	N/A	INTRINSIC
low complexity region	1290	1306	N/A	INTRINSIC
low complexity region	1345	1361	N/A	INTRINSIC
low complexity region	1937	1953	N/A	INTRINSIC
low complexity region	1996	2010	N/A	INTRINSIC
low complexity region	2150	2161	N/A	INTRINSIC
low complexity region	2296	2307	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000166726

SMART Domains

Protein: ENSMUSP00000132263
Gene: ENSMUSG00000034751

Domain	Start	End	E-Value	Type
low complexity region	23	51	N/A	INTRINSIC
Pfam:DUF1908	256	530	4.2e-145	PFAM
S_TKc	568	841	4.13e-98	SMART
S_TK_X	842	906	3.79e-2	SMART
low complexity region	922	935	N/A	INTRINSIC
low complexity region	995	1008	N/A	INTRINSIC
low complexity region	1035	1070	N/A	INTRINSIC
PDZ	1080	1160	2.34e-15	SMART
low complexity region	1180	1201	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167058
AA Change: C2370S

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000128464
Gene: ENSMUSG00000034751
AA Change: C2370S

Domain	Start	End	E-Value	Type
low complexity region	23	51	N/A	INTRINSIC
Pfam:DUF1908	256	529	5.1e-134	PFAM
S_TKc	568	841	4.13e-98	SMART
S_TK_X	842	906	3.79e-2	SMART
low complexity region	922	935	N/A	INTRINSIC
low complexity region	995	1008	N/A	INTRINSIC
low complexity region	1017	1034	N/A	INTRINSIC
low complexity region	1102	1137	N/A	INTRINSIC
PDZ	1147	1227	2.34e-15	SMART
low complexity region	1247	1264	N/A	INTRINSIC
low complexity region	1288	1299	N/A	INTRINSIC
low complexity region	1304	1316	N/A	INTRINSIC
low complexity region	1319	1341	N/A	INTRINSIC
low complexity region	1379	1396	N/A	INTRINSIC
low complexity region	1467	1483	N/A	INTRINSIC
low complexity region	1522	1538	N/A	INTRINSIC
low complexity region	2114	2130	N/A	INTRINSIC
low complexity region	2173	2187	N/A	INTRINSIC
low complexity region	2327	2338	N/A	INTRINSIC
low complexity region	2473	2484	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170878

SMART Domains

Protein: ENSMUSP00000127880
Gene: ENSMUSG00000021624

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
PDB:3T6Q\|B	21	86	3e-38	PDB
SCOP:d1m0za_	35	84	4e-4	SMART
Blast:LRR	51	75	1e-5	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000171791
AA Change: C2178S

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000131651
Gene: ENSMUSG00000034751
AA Change: C2178S

Domain	Start	End	E-Value	Type
Pfam:DUF1908	64	338	1.2e-144	PFAM
S_TKc	376	649	4.13e-98	SMART
S_TK_X	650	714	3.79e-2	SMART
low complexity region	730	743	N/A	INTRINSIC
low complexity region	803	816	N/A	INTRINSIC
low complexity region	825	842	N/A	INTRINSIC
low complexity region	910	945	N/A	INTRINSIC
PDZ	955	1035	2.34e-15	SMART
low complexity region	1055	1072	N/A	INTRINSIC
low complexity region	1096	1107	N/A	INTRINSIC
low complexity region	1112	1124	N/A	INTRINSIC
low complexity region	1127	1149	N/A	INTRINSIC
low complexity region	1187	1204	N/A	INTRINSIC
low complexity region	1275	1291	N/A	INTRINSIC
low complexity region	1330	1346	N/A	INTRINSIC
low complexity region	1922	1938	N/A	INTRINSIC
low complexity region	1981	1995	N/A	INTRINSIC
low complexity region	2135	2146	N/A	INTRINSIC
low complexity region	2281	2292	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172138

Predicted Effect

unknown
Transcript: ENSMUST00000194446
AA Change: C2202S

Meta Mutation Damage Score

0.0622

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.7%
20x: 96.3%

Validation Efficiency

98% (97/99)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule-associated serine/threonine protein kinases. The proteins in this family contain a domain that gives the kinase the ability to determine its own scaffold to control the effects of their kinase activities. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit malocclusion. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001C19Rik	AC	A	17: 47,433,423		probably benign	Het
4931409K22Rik	C	T	5: 24,552,040		probably benign	Het
6720489N17Rik	A	T	13: 62,607,396	I36N	probably benign	Het
Abcb4	T	C	5: 8,958,431	S1200P	probably damaging	Het
Acadsb	A	G	7: 131,443,653	Y438C	probably benign	Het
Acp7	A	C	7: 28,614,413	W399G	probably damaging	Het
Actr3b	A	G	5: 25,822,405	T113A	possibly damaging	Het
Adgrv1	T	C	13: 81,506,140	D2204G	probably benign	Het
Ago1	A	G	4: 126,441,911	V669A	possibly damaging	Het
Ang5	T	A	14: 43,962,521	L14Q	probably null	Het
Aoc1	T	C	6: 48,906,440	Y417H	possibly damaging	Het
Arhgap32	T	C	9: 32,247,497	I186T	probably damaging	Het
Atf2	A	T	2: 73,845,511		probably null	Het
Atg4a	A	G	X: 140,990,235	I91V	probably benign	Het
Atp7b	T	G	8: 21,998,266	T1102P	probably damaging	Het
Bend5	A	C	4: 111,431,010		probably benign	Het
Camkk2	T	C	5: 122,746,335	D341G	probably damaging	Het
Cast	T	A	13: 74,739,905	I208L	probably damaging	Het
Ccdc141	A	T	2: 77,132,262	W113R	probably damaging	Het
Cdk14	T	A	5: 4,888,924	M433L	probably benign	Het
Cel	A	G	2: 28,561,192	F51S	probably damaging	Het
Cenpc1	A	G	5: 86,016,203	L853S	probably damaging	Het
Cep162	C	A	9: 87,206,914	D972Y	probably damaging	Het
Clasrp	A	G	7: 19,586,585		probably benign	Het
Cntnap5c	T	A	17: 58,330,315	N1062K	probably benign	Het
Col3a1	A	G	1: 45,321,632	D74G	unknown	Het
Copb1	T	A	7: 114,253,875	D29V	possibly damaging	Het
Cox6a1	C	T	5: 115,348,848	E35K	possibly damaging	Het
Cyp2b9	G	A	7: 26,173,605		probably null	Het
Ddx46	A	G	13: 55,647,708	K177E	possibly damaging	Het
Dmbt1	T	C	7: 131,090,494	F823L	probably benign	Het
Drc7	A	T	8: 95,075,009	H666L	probably benign	Het
Fam228a	T	C	12: 4,737,775		probably benign	Het
Fam71e2	T	A	7: 4,771,021	M31L	probably benign	Het
Fam83e	A	T	7: 45,728,769	K406*	probably null	Het
Fam83e	A	T	7: 45,728,770	K406M	possibly damaging	Het
Fam90a1a	T	A	8: 21,963,517	L296Q	possibly damaging	Het
Fat1	A	G	8: 44,950,371	Y53C	probably damaging	Het
Fhdc1	T	C	3: 84,446,046	E624G	probably benign	Het
Fryl	T	A	5: 73,072,844	N1657Y	possibly damaging	Het
Fsip2	T	A	2: 82,962,751	D417E	probably benign	Het
Greb1l	A	G	18: 10,503,307	M453V	possibly damaging	Het
Gtf2b	A	G	3: 142,781,424	D207G	probably benign	Het
Has3	C	A	8: 106,874,256	L117I	probably damaging	Het
Jmjd1c	T	A	10: 67,225,294	I1142N	probably damaging	Het
Lipt2	C	T	7: 100,159,394	T38I	probably benign	Het
Magea2	A	T	X: 155,027,859	L243Q	probably damaging	Het
Mctp2	A	G	7: 72,185,820	L543P	probably damaging	Het
Mphosph9	C	T	5: 124,283,659	V740I	probably benign	Het
Mut	A	T	17: 40,956,319	I595F	probably benign	Het
Myo1e	G	A	9: 70,378,373		probably null	Het
Nlrc4	A	G	17: 74,445,630	I586T	probably damaging	Het
Nom1	T	A	5: 29,437,752	V417D	probably damaging	Het
Nphs1	A	T	7: 30,467,992	I782F	possibly damaging	Het
Numa1	A	G	7: 102,000,791	E1243G	probably damaging	Het
Olfr1000	T	A	2: 85,608,463	Y149F	possibly damaging	Het
Olfr1254	T	C	2: 89,788,470	H294R	probably benign	Het
Olfr1290	T	C	2: 111,489,978	Y60C	probably damaging	Het
Olfr474	A	T	7: 107,955,037	Y132F	probably damaging	Het
Olfr676	A	G	7: 105,035,819	Y207C	probably benign	Het
Orai2	C	T	5: 136,161,600	V52I	probably damaging	Het
Osbpl5	A	G	7: 143,709,094	C186R	probably damaging	Het
Osbpl6	A	G	2: 76,584,474	E403G	probably damaging	Het
Padi4	G	A	4: 140,759,940	T217I	possibly damaging	Het
Parm1	C	T	5: 91,594,121	T116I	possibly damaging	Het
Pde4dip	T	A	3: 97,718,184	Q1366L	probably damaging	Het
Phgdh	T	C	3: 98,328,291	K108E	probably benign	Het
Pold1	T	C	7: 44,533,799		probably null	Het
Ppp1r37	G	T	7: 19,562,018		probably benign	Het
Sdk2	T	C	11: 113,830,794	N1332S	probably benign	Het
Sema6d	A	G	2: 124,664,150	D626G	probably damaging	Het
Skiv2l2	A	T	13: 112,876,512	M890K	probably damaging	Het
Slc18b1	A	G	10: 23,810,922	N212S	probably benign	Het
Slc2a9	T	C	5: 38,453,199	T86A	probably damaging	Het
Slco1a6	A	T	6: 142,091,016	M555K	probably benign	Het
Sntg2	C	T	12: 30,236,688	W302*	probably null	Het
Spata22	T	A	11: 73,340,475	M185K	possibly damaging	Het
Stk35	T	A	2: 129,810,507	Y309*	probably null	Het
Taar8c	A	G	10: 24,101,071	V281A	probably benign	Het
Thoc1	C	A	18: 9,993,466	D608E	possibly damaging	Het
Tmem121b	A	T	6: 120,492,069	Y562*	probably null	Het
Tmem121b	A	G	6: 120,492,071	Y562H	probably damaging	Het
Tmtc4	A	T	14: 122,941,408	I449N	probably benign	Het
Tmub1	C	A	5: 24,446,924	G14V	possibly damaging	Het
Tmub1	G	A	5: 24,447,177		probably benign	Het
Tshz2	A	G	2: 169,886,477	T529A	probably damaging	Het
Ugdh	A	T	5: 65,417,115		probably benign	Het
Usp25	A	G	16: 77,113,794	K913E	probably benign	Het
Vgf	A	G	5: 137,031,547		probably benign	Het
Vmn2r19	T	A	6: 123,329,886	F451Y	probably benign	Het
Vmn2r59	A	T	7: 42,012,245	C715*	probably null	Het
Vps9d1	C	A	8: 123,245,121	A582S	probably benign	Het
Xbp1	T	G	11: 5,524,841	H247Q	probably damaging	Het
Zfp319	A	T	8: 95,328,501	M358K	possibly damaging	Het
Zfp438	A	T	18: 5,213,508	N483K	probably damaging	Het
Zfp518b	T	C	5: 38,671,636	N1009D	possibly damaging	Het
Zfp644	A	T	5: 106,635,845	H945Q	probably damaging	Het
Zgrf1	T	A	3: 127,561,997	S291T	probably benign	Het

Other mutations in Mast4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00703:Mast4	APN	13	102770767	nonsense	probably null
IGL00933:Mast4	APN	13	102735366	missense	probably damaging	0.97
IGL01113:Mast4	APN	13	102774236	missense	probably damaging	1.00
IGL01461:Mast4	APN	13	102754068	missense	probably damaging	1.00
IGL01569:Mast4	APN	13	102761015	missense	probably damaging	1.00
IGL01697:Mast4	APN	13	102767893	missense	probably damaging	1.00
IGL01725:Mast4	APN	13	102750512	critical splice donor site	probably null
IGL01734:Mast4	APN	13	102737615	missense	probably damaging	0.98
IGL01738:Mast4	APN	13	102737241	missense	probably damaging	1.00
IGL01739:Mast4	APN	13	102774273	missense	probably damaging	1.00
IGL02299:Mast4	APN	13	102737974	missense	probably benign	0.44
IGL02479:Mast4	APN	13	102742037	missense	probably damaging	1.00
IGL02485:Mast4	APN	13	102735496	missense	probably benign	0.02
IGL02528:Mast4	APN	13	102853823	makesense	probably null
IGL02850:Mast4	APN	13	102754232	missense	probably damaging	1.00
IGL02900:Mast4	APN	13	102735676	missense	probably benign
IGL03064:Mast4	APN	13	102760964	nonsense	probably null
IGL03124:Mast4	APN	13	102738245	missense	probably damaging	1.00
IGL03146:Mast4	APN	13	102737655	missense	probably benign	0.00
IGL03221:Mast4	APN	13	102754256	missense	possibly damaging	0.95
IGL03284:Mast4	APN	13	102751397	missense	probably damaging	1.00
IGL03406:Mast4	APN	13	102737107	missense	possibly damaging	0.46
buck	UTSW	13	102761293	critical splice donor site	probably null
doe	UTSW	13	102905677	missense	possibly damaging	0.85
skinnybones	UTSW	13	102804641	critical splice donor site	probably null
BB010:Mast4	UTSW	13	102772563	missense	probably damaging	0.99
BB020:Mast4	UTSW	13	102772563	missense	probably damaging	0.99
FR4304:Mast4	UTSW	13	102734862	utr 3 prime	probably benign
FR4340:Mast4	UTSW	13	102734857	frame shift	probably null
FR4340:Mast4	UTSW	13	102736317	small insertion	probably benign
FR4548:Mast4	UTSW	13	102736318	small insertion	probably benign
FR4976:Mast4	UTSW	13	102736312	small insertion	probably benign
FR4976:Mast4	UTSW	13	102739247	frame shift	probably null
NA:Mast4	UTSW	13	102742057	missense	probably damaging	1.00
PIT4466001:Mast4	UTSW	13	102804718	missense	probably damaging	1.00
PIT4469001:Mast4	UTSW	13	102804718	missense	probably damaging	1.00
PIT4472001:Mast4	UTSW	13	102804718	missense	probably damaging	1.00
R0009:Mast4	UTSW	13	102742058	missense	probably damaging	1.00
R0063:Mast4	UTSW	13	103334215	start gained	probably benign
R0242:Mast4	UTSW	13	102853842	missense	probably damaging	1.00
R0310:Mast4	UTSW	13	102754161	missense	possibly damaging	0.94
R0395:Mast4	UTSW	13	102735273	missense	probably damaging	1.00
R0454:Mast4	UTSW	13	102751560	missense	probably damaging	1.00
R0646:Mast4	UTSW	13	102758744	splice site	probably benign
R0744:Mast4	UTSW	13	102737387	missense	probably damaging	0.98
R0883:Mast4	UTSW	13	102853900	missense	probably damaging	1.00
R0905:Mast4	UTSW	13	102770784	missense	probably damaging	0.99
R1023:Mast4	UTSW	13	102735496	missense	probably benign	0.02
R1281:Mast4	UTSW	13	102750578	missense	probably damaging	1.00
R1376:Mast4	UTSW	13	102736408	missense	possibly damaging	0.46
R1376:Mast4	UTSW	13	102736408	missense	possibly damaging	0.46
R1473:Mast4	UTSW	13	102772519	missense	probably damaging	1.00
R1572:Mast4	UTSW	13	102736923	missense	possibly damaging	0.51
R1575:Mast4	UTSW	13	102739263	missense	probably damaging	1.00
R1865:Mast4	UTSW	13	102794117	missense	probably damaging	1.00
R2050:Mast4	UTSW	13	102751409	missense	probably damaging	1.00
R2060:Mast4	UTSW	13	102738846	missense	probably damaging	1.00
R2062:Mast4	UTSW	13	102759093	missense	probably benign	0.18
R2106:Mast4	UTSW	13	102750546	missense	probably damaging	1.00
R2118:Mast4	UTSW	13	102754205	missense	probably damaging	1.00
R2143:Mast4	UTSW	13	102735475	missense	possibly damaging	0.89
R2261:Mast4	UTSW	13	102798207	splice site	probably benign
R2370:Mast4	UTSW	13	102774187	missense	probably damaging	1.00
R2504:Mast4	UTSW	13	102738639	missense	probably damaging	0.96
R2509:Mast4	UTSW	13	102853842	missense	probably damaging	1.00
R2842:Mast4	UTSW	13	102736431	missense	probably benign	0.01
R3087:Mast4	UTSW	13	102853926	splice site	probably benign
R3434:Mast4	UTSW	13	102787379	missense	probably damaging	1.00
R3435:Mast4	UTSW	13	102787379	missense	probably damaging	1.00
R3763:Mast4	UTSW	13	102787419	missense	probably damaging	1.00
R3826:Mast4	UTSW	13	102738811	missense	probably damaging	1.00
R3829:Mast4	UTSW	13	102738811	missense	probably damaging	1.00
R3830:Mast4	UTSW	13	102738811	missense	probably damaging	1.00
R3913:Mast4	UTSW	13	102758669	missense	probably damaging	1.00
R3914:Mast4	UTSW	13	102739321	nonsense	probably null
R4021:Mast4	UTSW	13	102739321	nonsense	probably null
R4022:Mast4	UTSW	13	102739321	nonsense	probably null
R4022:Mast4	UTSW	13	102853869	missense	probably damaging	1.00
R4210:Mast4	UTSW	13	102739205	missense	probably damaging	1.00
R4342:Mast4	UTSW	13	102774248	missense	probably damaging	1.00
R4580:Mast4	UTSW	13	102737258	nonsense	probably null
R4627:Mast4	UTSW	13	103334021	missense	possibly damaging	0.92
R4711:Mast4	UTSW	13	103334119	missense	probably benign	0.01
R4732:Mast4	UTSW	13	102772572	missense	probably damaging	0.99
R4733:Mast4	UTSW	13	102772572	missense	probably damaging	0.99
R4833:Mast4	UTSW	13	102774184	critical splice donor site	probably null
R4995:Mast4	UTSW	13	102905754	intron	probably benign
R5059:Mast4	UTSW	13	102750563	missense	probably damaging	1.00
R5073:Mast4	UTSW	13	102738883	nonsense	probably null
R5101:Mast4	UTSW	13	102736356	missense	probably benign	0.01
R5526:Mast4	UTSW	13	102754215	missense	possibly damaging	0.48
R5599:Mast4	UTSW	13	102737479	missense	probably damaging	1.00
R5673:Mast4	UTSW	13	102794072	missense	probably damaging	1.00
R5694:Mast4	UTSW	13	102774193	nonsense	probably null
R5906:Mast4	UTSW	13	102735744	missense	probably benign	0.31
R5908:Mast4	UTSW	13	102738256	missense	probably damaging	1.00
R5947:Mast4	UTSW	13	102735640	missense	probably benign
R5987:Mast4	UTSW	13	102758734	missense	probably damaging	1.00
R6143:Mast4	UTSW	13	102853883	missense	probably damaging	1.00
R6154:Mast4	UTSW	13	102787421	missense	probably damaging	1.00
R6169:Mast4	UTSW	13	102787421	missense	probably damaging	1.00
R6239:Mast4	UTSW	13	102736209	missense	probably benign	0.01
R6327:Mast4	UTSW	13	102761382	missense	probably damaging	1.00
R6356:Mast4	UTSW	13	102735985	missense	possibly damaging	0.80
R6432:Mast4	UTSW	13	102905677	missense	possibly damaging	0.85
R6522:Mast4	UTSW	13	102761293	critical splice donor site	probably null
R6667:Mast4	UTSW	13	102737496	missense	probably damaging	1.00
R6941:Mast4	UTSW	13	102804714	missense	probably damaging	1.00
R6968:Mast4	UTSW	13	102798078	missense	probably damaging	1.00
R6968:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6970:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6980:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6991:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6992:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6993:Mast4	UTSW	13	102735974	missense	probably benign	0.28
R6993:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R7083:Mast4	UTSW	13	102737715	missense	probably damaging	1.00
R7241:Mast4	UTSW	13	103334000	missense	possibly damaging	0.87
R7242:Mast4	UTSW	13	102738478	missense	probably damaging	1.00
R7246:Mast4	UTSW	13	102794003	missense	probably damaging	1.00
R7332:Mast4	UTSW	13	102751424	missense	possibly damaging	0.61
R7453:Mast4	UTSW	13	102804641	critical splice donor site	probably null
R7514:Mast4	UTSW	13	102787426	nonsense	probably null
R7697:Mast4	UTSW	13	102739203	missense	probably damaging	1.00
R7820:Mast4	UTSW	13	102754088	missense	probably damaging	1.00
R7874:Mast4	UTSW	13	102739275	missense	probably damaging	1.00
R7933:Mast4	UTSW	13	102772563	missense	probably damaging	0.99
R8042:Mast4	UTSW	13	102781245	missense	probably damaging	0.96
R8060:Mast4	UTSW	13	102737676	missense	possibly damaging	0.89
R8172:Mast4	UTSW	13	102953125	critical splice donor site	probably null
R8206:Mast4	UTSW	13	102735739	missense	probably damaging	1.00
R8248:Mast4	UTSW	13	102738721	missense	probably damaging	1.00
R8283:Mast4	UTSW	13	102758669	missense	probably damaging	1.00
R8346:Mast4	UTSW	13	102751478	missense	probably damaging	0.99
R8434:Mast4	UTSW	13	102761392	missense	probably damaging	1.00
RF005:Mast4	UTSW	13	102736307	small insertion	probably benign
RF015:Mast4	UTSW	13	102739247	frame shift	probably null
RF019:Mast4	UTSW	13	102736307	small insertion	probably benign
RF037:Mast4	UTSW	13	102739241	small deletion	probably benign
RF039:Mast4	UTSW	13	102739241	small deletion	probably benign
RF040:Mast4	UTSW	13	102739241	small deletion	probably benign
Z1088:Mast4	UTSW	13	102738519	missense	probably damaging	1.00
Z1176:Mast4	UTSW	13	102738460	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTTTCAGCCAGTGACTTCTG -3'
(R):5'- GTCCTCTCGATGCCAAACTG -3'

Sequencing Primer
(F):5'- GGCTCAGAGAAGCCCTT -3'
(R):5'- ACCAATGGAGGGTGTCCC -3'

Posted On

2014-10-16