Incidental Mutation 'R2302:Sftpd'
ID244471
Institutional Source Beutler Lab
Gene Symbol Sftpd
Ensembl Gene ENSMUSG00000021795
Gene Namesurfactant associated protein D
SynonymsSP-D, Sftp4
MMRRC Submission 040301-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R2302 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location41172214-41185149 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41172442 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 340 (E340V)
Ref Sequence ENSEMBL: ENSMUSP00000076383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077136]
Predicted Effect probably damaging
Transcript: ENSMUST00000077136
AA Change: E340V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076383
Gene: ENSMUSG00000021795
AA Change: E340V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Collagen 40 96 5.7e-11 PFAM
low complexity region 99 117 N/A INTRINSIC
low complexity region 123 150 N/A INTRINSIC
Pfam:Collagen 162 224 3.3e-12 PFAM
CLECT 252 373 7.38e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225892
Meta Mutation Damage Score 0.3839 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the innate immune response, protecting the lungs against inhaled microorganisms and chemicals. The encoded protein may also be involved in surfactant metabolism. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit increased pool sizes of alveolar and tissue phosphatidylcholine, accumulation of surfactant lipids, altered phospholipid structure, emphysema, and pulmonary fibrosis and chronic inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agpat2 A T 2: 26,604,195 W6R possibly damaging Het
Ahrr C A 13: 74,277,661 V72F probably damaging Het
Ank1 G A 8: 23,119,399 C1369Y probably damaging Het
Cdh3 C A 8: 106,545,069 P538Q probably damaging Het
Cnn2 C G 10: 79,991,399 R35G possibly damaging Het
Csmd3 C A 15: 48,314,051 A364S probably benign Het
Dhcr7 A G 7: 143,837,892 T73A probably benign Het
Gbp9 T C 5: 105,094,092 N200D possibly damaging Het
Hyls1 T C 9: 35,564,069 E3G possibly damaging Het
Ifngr1 T C 10: 19,609,645 L464P probably damaging Het
Kdm1b TCATTGTCC TCATTGTCCATTGTCC 13: 47,064,088 probably null Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lhfpl2 T C 13: 94,174,546 V108A probably benign Het
Lrrc7 C G 3: 158,135,244 G1386R probably damaging Het
Mlc1 A G 15: 88,965,437 V231A possibly damaging Het
Mup4 T A 4: 59,960,702 probably null Het
Myh8 A T 11: 67,286,239 R406W probably damaging Het
Poldip3 T C 15: 83,129,268 probably benign Het
Pomt1 G A 2: 32,243,659 G216S probably benign Het
Ppil6 T A 10: 41,501,799 C169S probably damaging Het
Prokr2 A G 2: 132,381,184 I146T probably damaging Het
Rab3b T C 4: 108,929,443 V130A probably damaging Het
Reck T A 4: 43,931,015 I672N probably benign Het
Scn1a T C 2: 66,277,745 T1546A probably damaging Het
Slco5a1 C T 1: 12,879,262 G635S probably damaging Het
Slfn10-ps A T 11: 83,028,930 noncoding transcript Het
Svopl A T 6: 38,041,166 probably benign Het
Tbx5 A G 5: 119,841,859 K157E probably damaging Het
Ttn A T 2: 76,894,352 C6333S probably benign Het
Zfp609 T C 9: 65,794,897 K158E possibly damaging Het
Zscan20 T C 4: 128,588,264 N535S probably damaging Het
Other mutations in Sftpd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01640:Sftpd APN 14 41172635 missense probably benign 0.32
IGL02252:Sftpd APN 14 41172514 missense probably damaging 1.00
IGL02283:Sftpd APN 14 41172466 missense probably benign 0.01
R1474:Sftpd UTSW 14 41172427 missense probably damaging 0.99
R4282:Sftpd UTSW 14 41172580 missense probably benign 0.03
R6945:Sftpd UTSW 14 41174492 missense possibly damaging 0.88
R8069:Sftpd UTSW 14 41172581 missense probably benign
R8463:Sftpd UTSW 14 41175626 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGGTCTGAGCCATAGTACACTGG -3'
(R):5'- AAGCCTTTTGAGGATGCCCAG -3'

Sequencing Primer
(F):5'- AGTACACTGGTTAAACTCCTGGC -3'
(R):5'- TGCCCAGGAGATGTGCAAAC -3'
Posted On2014-10-30