Incidental Mutation 'R0278:Cenpu'
ID24470
Institutional Source Beutler Lab
Gene Symbol Cenpu
Ensembl Gene ENSMUSG00000031629
Gene Namecentromere protein U
Synonyms1700029A22Rik, Mlf1ip
MMRRC Submission 038500-MU
Accession Numbers

Genbank: NM_027973; MGI: 1919126

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0278 (G1)
Quality Score166
Status Not validated
Chromosome8
Chromosomal Location46552028-46580007 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 46578309 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 242 (A242T)
Ref Sequence ENSEMBL: ENSMUSP00000091239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034045] [ENSMUST00000040468] [ENSMUST00000093518] [ENSMUST00000135432] [ENSMUST00000136335] [ENSMUST00000209787] [ENSMUST00000211400]
Predicted Effect probably damaging
Transcript: ENSMUST00000034045
AA Change: A392T

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034045
Gene: ENSMUSG00000031629
AA Change: A392T

DomainStartEndE-ValueType
low complexity region 58 66 N/A INTRINSIC
Pfam:CENP-U 138 312 6.5e-74 PFAM
low complexity region 340 354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040468
SMART Domains Protein: ENSMUSP00000036119
Gene: ENSMUSG00000038225

DomainStartEndE-ValueType
Pfam:Herpes_UL52 384 448 1.3e-19 PFAM
low complexity region 465 478 N/A INTRINSIC
low complexity region 491 516 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093518
AA Change: A242T

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091239
Gene: ENSMUSG00000031629
AA Change: A242T

DomainStartEndE-ValueType
Pfam:CENP-U 39 162 4.6e-61 PFAM
low complexity region 190 204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135432
Predicted Effect probably benign
Transcript: ENSMUST00000136335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136724
Predicted Effect probably benign
Transcript: ENSMUST00000209787
Predicted Effect probably benign
Transcript: ENSMUST00000211400
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.4%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The centromere is a specialized chromatin domain, present throughout the cell cycle, that acts as a platform on which the transient assembly of the kinetochore occurs during mitosis. All active centromeres are characterized by the presence of long arrays of nucleosomes in which CENPA (MIM 117139) replaces histone H3 (see MIM 601128). MLF1IP, or CENPU, is an additional factor required for centromere assembly (Foltz et al., 2006 [PubMed 16622419]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E7.5 and E9.5, small embryo size and thickened visceral endoderm. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, other(2) Gene trapped(8)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,378,215 S3429R probably damaging Het
Abca3 A G 17: 24,381,920 D436G probably benign Het
Acacb C A 5: 114,233,259 Y1816* probably null Het
Acer3 T C 7: 98,261,597 Y86C probably damaging Het
Adgre1 A G 17: 57,447,872 I657V probably benign Het
Akap1 A G 11: 88,845,194 V214A probably benign Het
Ankrd42 T C 7: 92,631,657 R22G possibly damaging Het
Apc2 C T 10: 80,312,813 P1234S possibly damaging Het
Atp13a4 A G 16: 29,454,834 I441T probably damaging Het
Col6a6 A T 9: 105,767,288 V1267E possibly damaging Het
Crhr2 T C 6: 55,117,531 T58A probably benign Het
Ddx6 T G 9: 44,631,425 C385G probably damaging Het
Dnah7a A T 1: 53,504,146 N2288K probably benign Het
Egfl8 A T 17: 34,614,368 probably null Het
Elmo2 A T 2: 165,297,367 I420N probably damaging Het
Elovl4 A G 9: 83,783,195 F113L probably benign Het
Fancd2 T A 6: 113,548,448 probably null Het
Fbxl13 A G 5: 21,523,910 V456A probably benign Het
Fgfr2 A T 7: 130,261,862 probably null Het
Fkbpl A T 17: 34,645,410 R51* probably null Het
Fn3krp G A 11: 121,421,580 V40M probably damaging Het
Fnip1 A G 11: 54,489,343 probably null Het
Gm15446 A T 5: 109,943,415 Q511L probably benign Het
Gm7334 A G 17: 50,699,261 K192E probably damaging Het
H2-Q10 A T 17: 35,473,307 T282S possibly damaging Het
Hspa9 A G 18: 34,940,910 V482A possibly damaging Het
Ica1l A T 1: 60,013,996 S128T probably benign Het
Il7r A T 15: 9,516,337 I126K probably damaging Het
Kcnj8 T C 6: 142,570,348 E11G probably benign Het
Klkb1 A C 8: 45,272,409 F498V probably benign Het
Lama1 A G 17: 67,810,183 E2491G probably null Het
Lhfpl2 T C 13: 94,174,435 V71A probably benign Het
Lin9 T C 1: 180,665,923 I198T probably damaging Het
Lrrc7 T A 3: 158,179,795 M431L possibly damaging Het
Nmt2 A G 2: 3,325,387 T519A probably benign Het
Olfr1043 A T 2: 86,162,579 Y123* probably null Het
Olfr1247 A T 2: 89,609,763 L113Q probably damaging Het
Olfr1247 G T 2: 89,609,764 L113M probably damaging Het
Olfr1490 C A 19: 13,654,764 L112I probably damaging Het
Olfr1490 T A 19: 13,654,765 L112H probably damaging Het
Olfr412 T C 11: 74,365,202 F178L probably damaging Het
Olfr871 G T 9: 20,212,886 C179F probably damaging Het
Parp4 A G 14: 56,607,523 R624G probably damaging Het
Pex16 C T 2: 92,381,056 P325S probably damaging Het
Pik3ca T C 3: 32,439,753 M288T possibly damaging Het
Pla2g5 C T 4: 138,800,656 D100N probably benign Het
Prss43 T A 9: 110,827,362 M39K probably benign Het
Psd4 T C 2: 24,394,438 S105P probably damaging Het
Ptprz1 T A 6: 23,000,817 S969T probably benign Het
Rad23b T A 4: 55,383,575 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rpl10l A G 12: 66,284,356 M1T probably null Het
Sec16a A G 2: 26,428,316 S1588P probably damaging Het
Sh3rf1 A T 8: 61,374,018 H602L probably damaging Het
Sparcl1 A T 5: 104,088,397 S497T probably benign Het
Spata13 A G 14: 60,692,088 Y365C probably benign Het
Trim5 T C 7: 104,279,675 N20D probably benign Het
Vmn1r201 G T 13: 22,475,024 W136L probably damaging Het
Vmn2r112 A G 17: 22,603,006 I222V probably benign Het
Vmn2r56 A T 7: 12,715,717 V198D probably damaging Het
Wapl A G 14: 34,692,612 D477G possibly damaging Het
Zfp202 C A 9: 40,208,482 H194N probably benign Het
Zfp212 C T 6: 47,926,519 R13W probably damaging Het
Other mutations in Cenpu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02540:Cenpu APN 8 46578319 missense probably damaging 1.00
IGL02968:Cenpu APN 8 46556195 critical splice donor site probably null
3-1:Cenpu UTSW 8 46573488 unclassified probably benign
PIT4403001:Cenpu UTSW 8 46562529 missense possibly damaging 0.81
R1882:Cenpu UTSW 8 46556190 missense probably damaging 1.00
R1957:Cenpu UTSW 8 46572837 unclassified probably benign
R2894:Cenpu UTSW 8 46576349 missense probably damaging 1.00
R4528:Cenpu UTSW 8 46562422 nonsense probably null
R5279:Cenpu UTSW 8 46578910 unclassified probably null
R5384:Cenpu UTSW 8 46562499 missense probably benign
R6196:Cenpu UTSW 8 46562580 missense probably benign 0.28
R6562:Cenpu UTSW 8 46572823 missense possibly damaging 0.93
R6669:Cenpu UTSW 8 46576284 missense probably damaging 1.00
R7723:Cenpu UTSW 8 46576314 missense probably damaging 1.00
R7792:Cenpu UTSW 8 46562467 missense possibly damaging 0.92
R7895:Cenpu UTSW 8 46562464 missense probably benign
R7978:Cenpu UTSW 8 46562464 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGGTGGACAACTATCAAGATCGGC -3'
(R):5'- CAGCAGACGCTCCTAATTAACCAGG -3'

Sequencing Primer
(F):5'- ATCAAGATCGGCCTTGGTG -3'
(R):5'- CCTGGTGATGACTAACCTGTCAAG -3'
Posted On2013-04-16