Incidental Mutation 'R6562:Cenpu'
ID543464
Institutional Source Beutler Lab
Gene Symbol Cenpu
Ensembl Gene ENSMUSG00000031629
Gene Namecentromere protein U
Synonyms1700029A22Rik, Mlf1ip
MMRRC Submission
Accession Numbers

Genbank: NM_027973; MGI: 1919126

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6562 (G1)
Quality Score56.0072
Status Validated
Chromosome8
Chromosomal Location46552028-46580007 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46572823 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 132 (I132T)
Ref Sequence ENSEMBL: ENSMUSP00000091239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034045] [ENSMUST00000093518]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034045
AA Change: I282T

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034045
Gene: ENSMUSG00000031629
AA Change: I282T

DomainStartEndE-ValueType
low complexity region 58 66 N/A INTRINSIC
Pfam:CENP-U 138 312 6.5e-74 PFAM
low complexity region 340 354 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000093518
AA Change: I132T

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000091239
Gene: ENSMUSG00000031629
AA Change: I132T

DomainStartEndE-ValueType
Pfam:CENP-U 39 162 4.6e-61 PFAM
low complexity region 190 204 N/A INTRINSIC
Meta Mutation Damage Score 0.0982 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The centromere is a specialized chromatin domain, present throughout the cell cycle, that acts as a platform on which the transient assembly of the kinetochore occurs during mitosis. All active centromeres are characterized by the presence of long arrays of nucleosomes in which CENPA (MIM 117139) replaces histone H3 (see MIM 601128). MLF1IP, or CENPU, is an additional factor required for centromere assembly (Foltz et al., 2006 [PubMed 16622419]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E7.5 and E9.5, small embryo size and thickened visceral endoderm. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, other(2) Gene trapped(8)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,682,362 T1246S possibly damaging Het
4933434E20Rik A G 3: 90,063,236 K26E probably benign Het
Abt1 T G 13: 23,423,588 E82A probably damaging Het
Actr8 A G 14: 29,986,454 probably null Het
Akap12 G T 10: 4,356,141 E984* probably null Het
Ankrd13a C A 5: 114,804,392 probably benign Het
Ankrd13c T A 3: 157,999,672 S411T probably damaging Het
Arhgef28 A G 13: 97,988,139 probably null Het
Arhgef3 A T 14: 27,152,996 probably benign Het
Atad5 T C 11: 80,133,206 S1712P probably benign Het
Bbs12 A G 3: 37,320,240 E394G probably damaging Het
Ccdc158 T G 5: 92,662,722 K102N probably damaging Het
Ccdc169 A G 3: 55,150,814 N89S probably damaging Het
Cnrip1 G A 11: 17,078,539 W157* probably null Het
Ctnnd1 A G 2: 84,624,308 S53P probably benign Het
Dcpp3 AGGCCATGCTGGCC AGGCC 17: 23,917,598 probably benign Het
Dock7 A T 4: 98,991,410 V969D probably damaging Het
Ehd2 C A 7: 15,957,567 R280L probably benign Het
Entpd5 T C 12: 84,386,200 T218A probably damaging Het
Fcrls A C 3: 87,257,328 I297S probably benign Het
Frmpd2 T A 14: 33,571,915 L1346Q probably benign Het
Fry T C 5: 150,326,149 S142P probably damaging Het
Gbgt1 A T 2: 28,504,886 I179F probably damaging Het
Gm17067 A T 7: 42,708,729 S116R probably damaging Het
Gm5565 G T 5: 146,158,154 P261T probably damaging Het
Gm609 C T 16: 45,444,079 E39K probably benign Het
Kat6a T C 8: 22,911,787 F391L probably benign Het
Kcnmb4 A T 10: 116,473,184 probably null Het
Krt6a T A 15: 101,691,659 H386L probably benign Het
L3mbtl1 C T 2: 162,970,204 T723I probably benign Het
Lamb2 A T 9: 108,487,008 R1049W possibly damaging Het
Lrmda T C 14: 22,598,186 probably benign Het
Lysmd2 C T 9: 75,635,409 T95I unknown Het
Ndst3 A G 3: 123,552,532 S698P probably damaging Het
Nin T C 12: 70,055,954 D300G probably damaging Het
Nutf2 G T 8: 105,875,626 D23Y probably benign Het
Olfr801 G A 10: 129,670,139 P127S probably damaging Het
Ovgp1 A G 3: 105,980,273 Y300C probably damaging Het
Pgghg A G 7: 140,946,593 I633V probably benign Het
Pik3r3 C T 4: 116,299,809 Q496* probably null Het
Pkn3 G T 2: 30,080,687 probably null Het
Plin2 A T 4: 86,658,595 S298T probably benign Het
Prdm8 T C 5: 98,183,343 V18A possibly damaging Het
Rel C A 11: 23,757,026 G59* probably null Het
Siglecg A G 7: 43,409,057 R123G possibly damaging Het
Slc13a1 T A 6: 24,150,793 I49F probably benign Het
Slc39a10 T A 1: 46,835,564 T193S probably benign Het
Slc9a3 T A 13: 74,155,161 V191E probably damaging Het
Sult2b1 A C 7: 45,742,246 S39A probably benign Het
Tead1 A G 7: 112,861,443 T185A probably benign Het
Tmem67 A G 4: 12,053,445 probably null Het
Trim12c A T 7: 104,345,134 probably null Het
Trpm6 T A 19: 18,838,042 F1164Y probably damaging Het
Ube2d1 C T 10: 71,262,241 D16N probably benign Het
Vmn2r24 A T 6: 123,780,427 I85F probably benign Het
Vwde T A 6: 13,193,123 N406Y possibly damaging Het
Wdr54 A T 6: 83,155,068 probably null Het
Zcchc14 A T 8: 121,604,103 N840K probably damaging Het
Zfp451 C A 1: 33,762,179 S1052I possibly damaging Het
Other mutations in Cenpu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02540:Cenpu APN 8 46578319 missense probably damaging 1.00
IGL02968:Cenpu APN 8 46556195 critical splice donor site probably null
3-1:Cenpu UTSW 8 46573488 unclassified probably benign
PIT4403001:Cenpu UTSW 8 46562529 missense possibly damaging 0.81
R0278:Cenpu UTSW 8 46578309 missense probably damaging 0.99
R1882:Cenpu UTSW 8 46556190 missense probably damaging 1.00
R1957:Cenpu UTSW 8 46572837 unclassified probably benign
R2894:Cenpu UTSW 8 46576349 missense probably damaging 1.00
R4528:Cenpu UTSW 8 46562422 nonsense probably null
R5279:Cenpu UTSW 8 46578910 unclassified probably null
R5384:Cenpu UTSW 8 46562499 missense probably benign
R6196:Cenpu UTSW 8 46562580 missense probably benign 0.28
R6669:Cenpu UTSW 8 46576284 missense probably damaging 1.00
R7723:Cenpu UTSW 8 46576314 missense probably damaging 1.00
R7792:Cenpu UTSW 8 46562467 missense possibly damaging 0.92
R7895:Cenpu UTSW 8 46562464 missense probably benign
R7978:Cenpu UTSW 8 46562464 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATTGCAGCCCACCTTGTGTG -3'
(R):5'- TCTACAACCACAGGATCATGTC -3'

Sequencing Primer
(F):5'- CACCTTGTGTGCACGAGTG -3'
(R):5'- TAAAACATTTTAGAGTAGCCAGGTG -3'
Posted On2019-01-07