Incidental Mutation 'R2329:Batf3'
ID245779
Institutional Source Beutler Lab
Gene Symbol Batf3
Ensembl Gene ENSMUSG00000026630
Gene Namebasic leucine zipper transcription factor, ATF-like 3
Synonyms9130211I03Rik
MMRRC Submission 040320-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R2329 (G1)
Quality Score205
Status Not validated
Chromosome1
Chromosomal Location191097847-191108945 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 191108449 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027943] [ENSMUST00000027943]
Predicted Effect probably null
Transcript: ENSMUST00000027943
SMART Domains Protein: ENSMUSP00000027943
Gene: ENSMUSG00000026630

DomainStartEndE-ValueType
BRLZ 26 90 1.8e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000027943
SMART Domains Protein: ENSMUSP00000027943
Gene: ENSMUSG00000026630

DomainStartEndE-ValueType
BRLZ 26 90 1.8e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191621
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192268
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193771
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194833
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the basic leucine zipper protein family. The encoded protein functions as a transcriptional repressor when heterodimerizing with JUN. The protein may play a role in repression of interleukin-2 and matrix metalloproteinase-1 transcription.[provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for a null mutation lack CD8alpha+ dendritic cells, have dysfunctional cross-presentation of antigens, and generate lower numbers of memory CD8+ T cells in response to infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A C 13: 77,303,325 S843R probably benign Het
Adamts15 G T 9: 30,902,485 R795S probably damaging Het
Adora2a T A 10: 75,326,183 V52E probably damaging Het
Amph T A 13: 19,139,350 L594Q probably benign Het
Ccdc146 C T 5: 21,308,612 probably null Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Csn3 A G 5: 87,930,003 T123A possibly damaging Het
Cspg4 A G 9: 56,888,550 T1190A probably benign Het
Dab2 C A 15: 6,429,563 Q298K possibly damaging Het
Dpp6 T C 5: 27,451,288 probably null Het
Efcab6 C T 15: 83,950,048 R453Q possibly damaging Het
Ern2 C T 7: 122,173,487 M610I possibly damaging Het
Fnip1 A G 11: 54,466,107 D38G probably damaging Het
Fosb T C 7: 19,307,185 T128A probably benign Het
Gad2 G A 2: 22,668,289 V340M probably damaging Het
Gm19684 T A 17: 36,128,453 probably benign Het
Gstk1 T A 6: 42,246,914 D86E possibly damaging Het
Hus1 A G 11: 9,007,492 probably null Het
Kbtbd8 T C 6: 95,126,780 I547T probably benign Het
Mrpl38 T A 11: 116,132,019 H373L possibly damaging Het
Nostrin A T 2: 69,161,094 T144S probably damaging Het
Prl8a6 T C 13: 27,437,067 H60R probably benign Het
Ros1 A G 10: 52,162,887 I329T probably damaging Het
Scd2 T A 19: 44,298,053 Y107* probably null Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc34a3 T C 2: 25,229,410 T483A possibly damaging Het
Slc35c1 A T 2: 92,458,695 Y155* probably null Het
Susd1 T C 4: 59,379,715 D304G possibly damaging Het
Taf5 C T 19: 47,075,124 S371L probably benign Het
Tenm4 A G 7: 96,895,862 T2362A probably benign Het
Tsg101 A T 7: 46,891,120 D158E probably damaging Het
Ttn G A 2: 76,769,442 P19102S probably damaging Het
Ttn A G 2: 76,778,068 V17837A probably damaging Het
Uhrf1 C A 17: 56,310,671 probably null Het
Ulk4 C T 9: 121,272,887 E42K probably damaging Het
Vmn1r184 A T 7: 26,266,962 L44F probably damaging Het
Zfp932 A T 5: 110,009,540 H368L probably benign Het
Other mutations in Batf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0626:Batf3 UTSW 1 191100738 missense probably damaging 0.99
R1828:Batf3 UTSW 1 191098517 missense probably benign 0.09
R4960:Batf3 UTSW 1 191098510 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGTCATAATGCCCTGAATCACAG -3'
(R):5'- TCATCGTGGTAGACAGCTGG -3'

Sequencing Primer
(F):5'- ACTTCAGTAGTGTTGGTTCAGAAAG -3'
(R):5'- TGGTAGACAGCTGGCCACG -3'
Posted On2014-10-30