Incidental Mutation 'R2329:Kbtbd8'
ID245794
Institutional Source Beutler Lab
Gene Symbol Kbtbd8
Ensembl Gene ENSMUSG00000030031
Gene Namekelch repeat and BTB (POZ) domain containing 8
SynonymsSSEC 51, SSEC51, Takrp, SSEC-51
MMRRC Submission 040320-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.337) question?
Stock #R2329 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location95117240-95129790 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95126780 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 547 (I547T)
Ref Sequence ENSEMBL: ENSMUSP00000032107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032107] [ENSMUST00000119582] [ENSMUST00000122938]
Predicted Effect probably benign
Transcript: ENSMUST00000032107
AA Change: I547T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000032107
Gene: ENSMUSG00000030031
AA Change: I547T

DomainStartEndE-ValueType
BTB 49 147 7.37e-28 SMART
BACK 152 254 1.37e-26 SMART
Kelch 334 388 2.63e-3 SMART
Kelch 389 439 6.13e-4 SMART
Kelch 480 530 5.06e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119582
AA Change: I470T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113739
Gene: ENSMUSG00000030031
AA Change: I470T

DomainStartEndE-ValueType
Pfam:BTB 1 70 5.1e-14 PFAM
BACK 75 177 1.37e-26 SMART
Kelch 257 311 2.63e-3 SMART
Kelch 312 362 6.13e-4 SMART
Blast:Kelch 364 402 4e-18 BLAST
Kelch 403 453 5.06e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122938
SMART Domains Protein: ENSMUSP00000145009
Gene: ENSMUSG00000030031

DomainStartEndE-ValueType
BTB 65 142 1.4e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145387
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A C 13: 77,303,325 S843R probably benign Het
Adamts15 G T 9: 30,902,485 R795S probably damaging Het
Adora2a T A 10: 75,326,183 V52E probably damaging Het
Amph T A 13: 19,139,350 L594Q probably benign Het
Batf3 A T 1: 191,108,449 probably null Het
Ccdc146 C T 5: 21,308,612 probably null Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Csn3 A G 5: 87,930,003 T123A possibly damaging Het
Cspg4 A G 9: 56,888,550 T1190A probably benign Het
Dab2 C A 15: 6,429,563 Q298K possibly damaging Het
Dpp6 T C 5: 27,451,288 probably null Het
Efcab6 C T 15: 83,950,048 R453Q possibly damaging Het
Ern2 C T 7: 122,173,487 M610I possibly damaging Het
Fnip1 A G 11: 54,466,107 D38G probably damaging Het
Fosb T C 7: 19,307,185 T128A probably benign Het
Gad2 G A 2: 22,668,289 V340M probably damaging Het
Gm19684 T A 17: 36,128,453 probably benign Het
Gstk1 T A 6: 42,246,914 D86E possibly damaging Het
Hus1 A G 11: 9,007,492 probably null Het
Mrpl38 T A 11: 116,132,019 H373L possibly damaging Het
Nostrin A T 2: 69,161,094 T144S probably damaging Het
Prl8a6 T C 13: 27,437,067 H60R probably benign Het
Ros1 A G 10: 52,162,887 I329T probably damaging Het
Scd2 T A 19: 44,298,053 Y107* probably null Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc34a3 T C 2: 25,229,410 T483A possibly damaging Het
Slc35c1 A T 2: 92,458,695 Y155* probably null Het
Susd1 T C 4: 59,379,715 D304G possibly damaging Het
Taf5 C T 19: 47,075,124 S371L probably benign Het
Tenm4 A G 7: 96,895,862 T2362A probably benign Het
Tsg101 A T 7: 46,891,120 D158E probably damaging Het
Ttn G A 2: 76,769,442 P19102S probably damaging Het
Ttn A G 2: 76,778,068 V17837A probably damaging Het
Uhrf1 C A 17: 56,310,671 probably null Het
Ulk4 C T 9: 121,272,887 E42K probably damaging Het
Vmn1r184 A T 7: 26,266,962 L44F probably damaging Het
Zfp932 A T 5: 110,009,540 H368L probably benign Het
Other mutations in Kbtbd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Kbtbd8 APN 6 95126513 missense probably damaging 1.00
IGL01382:Kbtbd8 APN 6 95122230 missense probably damaging 1.00
IGL01459:Kbtbd8 APN 6 95122808 missense probably benign 0.10
IGL01656:Kbtbd8 APN 6 95118676 missense probably benign 0.02
IGL02100:Kbtbd8 APN 6 95122682 missense probably damaging 1.00
IGL02133:Kbtbd8 APN 6 95121732 splice site probably benign
IGL02532:Kbtbd8 APN 6 95126536 missense probably benign 0.17
IGL02982:Kbtbd8 APN 6 95126566 missense probably benign 0.01
IGL03074:Kbtbd8 APN 6 95122352 missense probably damaging 0.99
R0782:Kbtbd8 UTSW 6 95122232 missense probably damaging 1.00
R2075:Kbtbd8 UTSW 6 95126683 missense possibly damaging 0.47
R2698:Kbtbd8 UTSW 6 95126589 nonsense probably null
R3906:Kbtbd8 UTSW 6 95126584 missense probably damaging 1.00
R4276:Kbtbd8 UTSW 6 95126933 missense probably damaging 0.99
R4915:Kbtbd8 UTSW 6 95126534 missense possibly damaging 0.95
R5141:Kbtbd8 UTSW 6 95121839 missense probably damaging 1.00
R5294:Kbtbd8 UTSW 6 95121832 nonsense probably null
R5779:Kbtbd8 UTSW 6 95118534 missense probably benign
R6645:Kbtbd8 UTSW 6 95126749 nonsense probably null
R7073:Kbtbd8 UTSW 6 95121833 missense probably damaging 1.00
R7161:Kbtbd8 UTSW 6 95126696 missense probably benign 0.30
R7600:Kbtbd8 UTSW 6 95122592 missense probably damaging 1.00
R7731:Kbtbd8 UTSW 6 95118578 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAACCTGTGGAAATCATCAGCG -3'
(R):5'- CTAAGCCAGCTTCCTCAGTATG -3'

Sequencing Primer
(F):5'- GGAAATCATCAGCGTGTGTTTAC -3'
(R):5'- TAAGCCAGCTTCCTCAGTATGAGATG -3'
Posted On2014-10-30