Incidental Mutation 'R2329:Gm19684'
ID245818
Institutional Source Beutler Lab
Gene Symbol Gm19684
Ensembl Gene ENSMUSG00000092277
Gene Namepredicted gene, 19684
Synonyms
MMRRC Submission 040320-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R2329 (G1)
Quality Score82
Status Not validated
Chromosome17
Chromosomal Location36121678-36129692 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 36128453 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046131] [ENSMUST00000172968] [ENSMUST00000173128] [ENSMUST00000173322]
Predicted Effect probably benign
Transcript: ENSMUST00000046131
SMART Domains Protein: ENSMUSP00000040558
Gene: ENSMUSG00000092243

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:MHC_I 26 204 2.3e-81 PFAM
IGc1 220 285 8.12e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172968
SMART Domains Protein: ENSMUSP00000133748
Gene: ENSMUSG00000092243

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:MHC_I 26 204 1.5e-80 PFAM
IGc1 220 285 8.12e-13 SMART
Predicted Effect unknown
Transcript: ENSMUST00000173128
AA Change: S74T
SMART Domains Protein: ENSMUSP00000134339
Gene: ENSMUSG00000092277
AA Change: S74T

DomainStartEndE-ValueType
low complexity region 103 115 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173322
SMART Domains Protein: ENSMUSP00000133734
Gene: ENSMUSG00000092243

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:MHC_I 26 204 2.3e-81 PFAM
IGc1 220 285 8.12e-13 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A C 13: 77,303,325 S843R probably benign Het
Adamts15 G T 9: 30,902,485 R795S probably damaging Het
Adora2a T A 10: 75,326,183 V52E probably damaging Het
Amph T A 13: 19,139,350 L594Q probably benign Het
Batf3 A T 1: 191,108,449 probably null Het
Ccdc146 C T 5: 21,308,612 probably null Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Csn3 A G 5: 87,930,003 T123A possibly damaging Het
Cspg4 A G 9: 56,888,550 T1190A probably benign Het
Dab2 C A 15: 6,429,563 Q298K possibly damaging Het
Dpp6 T C 5: 27,451,288 probably null Het
Efcab6 C T 15: 83,950,048 R453Q possibly damaging Het
Ern2 C T 7: 122,173,487 M610I possibly damaging Het
Fnip1 A G 11: 54,466,107 D38G probably damaging Het
Fosb T C 7: 19,307,185 T128A probably benign Het
Gad2 G A 2: 22,668,289 V340M probably damaging Het
Gstk1 T A 6: 42,246,914 D86E possibly damaging Het
Hus1 A G 11: 9,007,492 probably null Het
Kbtbd8 T C 6: 95,126,780 I547T probably benign Het
Mrpl38 T A 11: 116,132,019 H373L possibly damaging Het
Nostrin A T 2: 69,161,094 T144S probably damaging Het
Prl8a6 T C 13: 27,437,067 H60R probably benign Het
Ros1 A G 10: 52,162,887 I329T probably damaging Het
Scd2 T A 19: 44,298,053 Y107* probably null Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc34a3 T C 2: 25,229,410 T483A possibly damaging Het
Slc35c1 A T 2: 92,458,695 Y155* probably null Het
Susd1 T C 4: 59,379,715 D304G possibly damaging Het
Taf5 C T 19: 47,075,124 S371L probably benign Het
Tenm4 A G 7: 96,895,862 T2362A probably benign Het
Tsg101 A T 7: 46,891,120 D158E probably damaging Het
Ttn G A 2: 76,769,442 P19102S probably damaging Het
Ttn A G 2: 76,778,068 V17837A probably damaging Het
Uhrf1 C A 17: 56,310,671 probably null Het
Ulk4 C T 9: 121,272,887 E42K probably damaging Het
Vmn1r184 A T 7: 26,266,962 L44F probably damaging Het
Zfp932 A T 5: 110,009,540 H368L probably benign Het
Other mutations in Gm19684
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0140:Gm19684 UTSW 17 36127427 unclassified probably benign
R0306:Gm19684 UTSW 17 36127408 unclassified probably benign
R0862:Gm19684 UTSW 17 36121900 unclassified probably benign
R4991:Gm19684 UTSW 17 36127472 unclassified probably benign
R5147:Gm19684 UTSW 17 36128519 missense probably damaging 0.99
R6340:Gm19684 UTSW 17 36127510 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTGAACTATCCTGAGAGAAGGG -3'
(R):5'- ACACGGGCACTATCAACATG -3'

Sequencing Primer
(F):5'- ACTATCCTGAGAGAAGGGAAATATTG -3'
(R):5'- GGGCACTATCAACATGCCTATGATG -3'
Posted On2014-10-30