Incidental Mutation 'R2359:Anxa9'
ID247057
Institutional Source Beutler Lab
Gene Symbol Anxa9
Ensembl Gene ENSMUSG00000015702
Gene Nameannexin A9
Synonyms
MMRRC Submission 040341-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2359 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location95296096-95307176 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 95302751 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 99 (L99R)
Ref Sequence ENSEMBL: ENSMUSP00000127424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015846] [ENSMUST00000107183] [ENSMUST00000123365] [ENSMUST00000164406]
Predicted Effect probably damaging
Transcript: ENSMUST00000015846
AA Change: L99R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000015846
Gene: ENSMUSG00000015702
AA Change: L99R

DomainStartEndE-ValueType
ANX 58 110 1.48e-17 SMART
ANX 130 182 6.56e-10 SMART
ANX 212 264 1.52e-1 SMART
ANX 287 339 1.03e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098867
Predicted Effect probably damaging
Transcript: ENSMUST00000107183
AA Change: L99R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102801
Gene: ENSMUSG00000015702
AA Change: L99R

DomainStartEndE-ValueType
ANX 58 110 1.48e-17 SMART
ANX 130 182 6.56e-10 SMART
ANX 212 264 1.52e-1 SMART
ANX 287 339 1.03e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123365
Predicted Effect probably damaging
Transcript: ENSMUST00000164406
AA Change: L99R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127424
Gene: ENSMUSG00000015702
AA Change: L99R

DomainStartEndE-ValueType
ANX 58 110 1.48e-17 SMART
ANX 130 182 6.56e-10 SMART
ANX 212 264 1.52e-1 SMART
ANX 287 339 1.03e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198947
Meta Mutation Damage Score 0.7778 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The annexins are a family of calcium-dependent phospholipid-binding proteins. Members of the annexin family contain 4 internal repeat domains, each of which includes a type II calcium-binding site. The calcium-binding sites are required for annexins to aggregate and cooperatively bind anionic phospholipids and extracellular matrix proteins. This gene encodes a divergent member of the annexin protein family in which all four homologous type II calcium-binding sites in the conserved tetrad core contain amino acid substitutions that ablate their function. However, structural analysis suggests that the conserved putative ion channel formed by the tetrad core is intact. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 A T 13: 64,312,651 C12S probably benign Het
Adam24 A G 8: 40,680,945 E484G possibly damaging Het
Akr1c20 C T 13: 4,523,277 G13D probably damaging Het
Alkbh3 T C 2: 94,008,113 T38A probably benign Het
Arfgef2 A T 2: 166,860,619 Y826F probably damaging Het
Arid2 G T 15: 96,361,878 L306F probably damaging Het
Ccdc141 C T 2: 77,170,402 V29M probably damaging Het
Cd55b A G 1: 130,418,121 S187P probably damaging Het
Cep63 A C 9: 102,594,564 L526V possibly damaging Het
Chtf8 G T 8: 106,885,416 probably null Het
Clca4b T A 3: 144,925,242 S286C probably damaging Het
Cpsf1 A G 15: 76,597,673 V1080A probably benign Het
Csf2rb2 C T 15: 78,292,776 V165I probably benign Het
Cyp2c40 A T 19: 39,777,954 V399E probably damaging Het
Dnmt3a T C 12: 3,901,599 S659P probably damaging Het
Efr3b G A 12: 3,980,136 probably benign Het
Epha8 A G 4: 136,946,032 I147T probably damaging Het
Fbxo48 G A 11: 16,953,602 W76* probably null Het
Ggt6 A T 11: 72,437,551 L254F possibly damaging Het
Gm11639 T C 11: 104,739,280 S967P possibly damaging Het
Gm4204 T A 1: 135,232,189 noncoding transcript Het
Golph3l A G 3: 95,591,964 probably null Het
Gtf2h3 A G 5: 124,590,876 K166R probably damaging Het
Hsp90aa1 A G 12: 110,694,569 probably null Het
Hyi A G 4: 118,360,341 R79G probably benign Het
Igbp1b G A 6: 138,657,715 P244S probably damaging Het
Ipo8 G A 6: 148,816,477 probably benign Het
Larp4b C A 13: 9,158,163 T391K probably damaging Het
Lrba T C 3: 86,348,750 V1133A probably benign Het
Med13 C T 11: 86,291,035 probably benign Het
Ncapd2 A G 6: 125,179,416 probably benign Het
Neurl1b T C 17: 26,441,595 F299L probably benign Het
Nosip G A 7: 45,074,026 A39T possibly damaging Het
Nsd1 A G 13: 55,213,711 D164G possibly damaging Het
Ntn1 G A 11: 68,385,612 T170M probably damaging Het
Polrmt A T 10: 79,736,562 L1079Q probably damaging Het
Rab30 A G 7: 92,835,797 D129G possibly damaging Het
Rwdd2b C T 16: 87,436,921 S97N probably benign Het
Slitrk3 T G 3: 73,049,345 D698A possibly damaging Het
Smarcd2 T C 11: 106,267,164 M93V probably benign Het
Tmprss4 A G 9: 45,185,832 V45A probably benign Het
Vmn1r22 A T 6: 57,900,989 M1K probably null Het
Vps13a A G 19: 16,652,679 probably benign Het
Other mutations in Anxa9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01567:Anxa9 APN 3 95302432 splice site probably benign
IGL01618:Anxa9 APN 3 95300536 unclassified probably null
IGL02272:Anxa9 APN 3 95305894 missense probably benign 0.11
R0012:Anxa9 UTSW 3 95308095 unclassified probably benign
R0128:Anxa9 UTSW 3 95302422 missense probably benign 0.02
R0130:Anxa9 UTSW 3 95302422 missense probably benign 0.02
R0356:Anxa9 UTSW 3 95308076 unclassified probably benign
R1656:Anxa9 UTSW 3 95300573 missense probably benign 0.02
R1967:Anxa9 UTSW 3 95300608 missense probably benign 0.00
R2180:Anxa9 UTSW 3 95306424 critical splice acceptor site probably null
R3155:Anxa9 UTSW 3 95302405 missense probably benign 0.04
R3156:Anxa9 UTSW 3 95302405 missense probably benign 0.04
R3767:Anxa9 UTSW 3 95301114 missense probably benign 0.00
R4693:Anxa9 UTSW 3 95297356 missense probably benign 0.00
R4974:Anxa9 UTSW 3 95308013 unclassified probably benign
R5435:Anxa9 UTSW 3 95297250 missense probably damaging 1.00
R6342:Anxa9 UTSW 3 95296790 makesense probably null
R7272:Anxa9 UTSW 3 95305873 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCCAGTCAACTAACTGTGC -3'
(R):5'- AGCACTGACATCCTGTGAGC -3'

Sequencing Primer
(F):5'- GCCAGTCAACTAACTGTGCTTCTTC -3'
(R):5'- GGCCTTCCTTGACCTATATC -3'
Posted On2014-10-30