Incidental Mutation 'R0128:Anxa9'
ID60501
Institutional Source Beutler Lab
Gene Symbol Anxa9
Ensembl Gene ENSMUSG00000015702
Gene Nameannexin A9
Synonyms
MMRRC Submission 038413-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0128 (G1)
Quality Score174
Status Validated
Chromosome3
Chromosomal Location95296096-95307176 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95302422 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 129 (S129P)
Ref Sequence ENSEMBL: ENSMUSP00000127424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015846] [ENSMUST00000107183] [ENSMUST00000123365] [ENSMUST00000164406]
Predicted Effect probably benign
Transcript: ENSMUST00000015846
AA Change: S129P

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000015846
Gene: ENSMUSG00000015702
AA Change: S129P

DomainStartEndE-ValueType
ANX 58 110 1.48e-17 SMART
ANX 130 182 6.56e-10 SMART
ANX 212 264 1.52e-1 SMART
ANX 287 339 1.03e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107183
AA Change: S129P

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000102801
Gene: ENSMUSG00000015702
AA Change: S129P

DomainStartEndE-ValueType
ANX 58 110 1.48e-17 SMART
ANX 130 182 6.56e-10 SMART
ANX 212 264 1.52e-1 SMART
ANX 287 339 1.03e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123365
Predicted Effect probably benign
Transcript: ENSMUST00000164406
AA Change: S129P

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000127424
Gene: ENSMUSG00000015702
AA Change: S129P

DomainStartEndE-ValueType
ANX 58 110 1.48e-17 SMART
ANX 130 182 6.56e-10 SMART
ANX 212 264 1.52e-1 SMART
ANX 287 339 1.03e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198947
Meta Mutation Damage Score 0.2535 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.6%
  • 10x: 93.0%
  • 20x: 79.3%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The annexins are a family of calcium-dependent phospholipid-binding proteins. Members of the annexin family contain 4 internal repeat domains, each of which includes a type II calcium-binding site. The calcium-binding sites are required for annexins to aggregate and cooperatively bind anionic phospholipids and extracellular matrix proteins. This gene encodes a divergent member of the annexin protein family in which all four homologous type II calcium-binding sites in the conserved tetrad core contain amino acid substitutions that ablate their function. However, structural analysis suggests that the conserved putative ion channel formed by the tetrad core is intact. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,575,639 probably benign Het
Abcd4 T G 12: 84,612,352 Q210P possibly damaging Het
Ablim2 G A 5: 35,809,176 probably benign Het
Actl6b A G 5: 137,555,065 N113S probably benign Het
Actn3 A T 19: 4,871,615 V179E probably damaging Het
Aff4 C A 11: 53,415,466 T1145N probably damaging Het
Ankrd42 G A 7: 92,591,859 Q431* probably null Het
Arfgef2 T G 2: 166,835,719 I88S probably damaging Het
Asap3 C A 4: 136,234,604 N285K probably damaging Het
Atp6v0a2 A G 5: 124,713,184 N477S probably damaging Het
Atp7b C T 8: 22,028,172 E205K possibly damaging Het
Atp8b5 T A 4: 43,369,715 probably null Het
C87436 G A 6: 86,469,827 G533D probably damaging Het
Ccdc138 T A 10: 58,528,360 I314N probably damaging Het
Ccs A G 19: 4,825,626 F237S probably damaging Het
Ccz1 T G 5: 144,009,294 probably benign Het
Cdcp2 C T 4: 107,106,707 probably benign Het
Chd1 A G 17: 17,393,567 N531S probably damaging Het
Clptm1 A T 7: 19,635,007 F476I probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cped1 T A 6: 22,121,039 Y373N probably benign Het
Cr2 A T 1: 195,166,231 V328D probably damaging Het
D630045J12Rik A T 6: 38,149,771 probably benign Het
Dcdc2a A T 13: 25,187,672 probably benign Het
Dlg1 G T 16: 31,858,065 probably null Het
Epb41l5 A C 1: 119,549,902 V705G possibly damaging Het
Ergic3 C A 2: 156,011,140 R43S possibly damaging Het
Flnb T C 14: 7,901,951 V938A probably damaging Het
Frmd4a T C 2: 4,604,092 Y928H probably damaging Het
Fyn C T 10: 39,511,982 T78M probably benign Het
Gdap2 A G 3: 100,201,995 T443A probably damaging Het
Ghrl A T 6: 113,717,168 probably benign Het
Gm1141 T C X: 71,939,555 C378R possibly damaging Het
Gm12166 A G 11: 46,052,293 M1T probably null Het
Gm4787 T A 12: 81,377,747 K546* probably null Het
Gm498 G T 7: 143,891,755 G178C probably damaging Het
Gm6576 C G 15: 27,026,000 noncoding transcript Het
Got1 C T 19: 43,524,377 D27N probably benign Het
Gucy2c C T 6: 136,704,249 V946I probably damaging Het
Hectd4 T C 5: 121,349,243 Y3434H possibly damaging Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Itpr1 A G 6: 108,471,209 probably benign Het
Kctd1 G A 18: 14,974,180 P743S probably benign Het
Klhl23 T C 2: 69,833,966 V553A probably damaging Het
Krt24 T C 11: 99,280,267 D495G probably damaging Het
L3hypdh C T 12: 72,077,143 probably null Het
Lipo3 C T 19: 33,557,106 probably null Het
Lman2l G T 1: 36,424,864 S171* probably null Het
Lrp1b T C 2: 41,511,508 D378G probably damaging Het
Map3k4 T A 17: 12,248,063 D1104V probably damaging Het
Mpeg1 T C 19: 12,461,223 V15A probably benign Het
Narf C T 11: 121,250,836 R356C probably damaging Het
Nebl T A 2: 17,393,023 Q487H possibly damaging Het
Olfm5 G A 7: 104,160,926 A76V probably benign Het
Olfr1090 T C 2: 86,753,887 M284V probably benign Het
Olfr339 T A 2: 36,422,287 D296E probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr656 A T 7: 104,618,581 I301F probably damaging Het
Olfr992 T A 2: 85,399,961 S191C probably damaging Het
Palb2 A T 7: 122,128,166 Y160* probably null Het
Paxip1 C T 5: 27,744,185 probably benign Het
Pclo A G 5: 14,679,797 probably benign Het
Pdcd11 G A 19: 47,119,862 V1223I probably benign Het
Pde6c T C 19: 38,169,365 probably benign Het
Prr12 A G 7: 45,050,039 probably benign Het
Prss39 T A 1: 34,502,200 probably benign Het
Samd5 A G 10: 9,674,939 W9R probably damaging Het
Sfr1 A G 19: 47,735,018 *320W probably null Het
Sh3bp4 A G 1: 89,145,314 N628S possibly damaging Het
Sim1 A T 10: 50,907,961 I104F probably damaging Het
Slc1a3 T C 15: 8,636,209 M519V probably benign Het
Smcp T A 3: 92,584,520 T7S unknown Het
Sp4 A G 12: 118,300,816 probably benign Het
Spag9 T A 11: 94,093,539 I327N probably damaging Het
Thbs4 G T 13: 92,754,410 H850N probably benign Het
Ubap2l A T 3: 90,021,373 S478T possibly damaging Het
Unc79 A G 12: 103,088,434 probably benign Het
Vmn2r85 A G 10: 130,419,185 probably benign Het
Wrap73 A G 4: 154,142,500 D19G possibly damaging Het
Other mutations in Anxa9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01567:Anxa9 APN 3 95302432 splice site probably benign
IGL01618:Anxa9 APN 3 95300536 unclassified probably null
IGL02272:Anxa9 APN 3 95305894 missense probably benign 0.11
R0012:Anxa9 UTSW 3 95308095 unclassified probably benign
R0130:Anxa9 UTSW 3 95302422 missense probably benign 0.02
R0356:Anxa9 UTSW 3 95308076 unclassified probably benign
R1656:Anxa9 UTSW 3 95300573 missense probably benign 0.02
R1967:Anxa9 UTSW 3 95300608 missense probably benign 0.00
R2180:Anxa9 UTSW 3 95306424 critical splice acceptor site probably null
R2359:Anxa9 UTSW 3 95302751 missense probably damaging 1.00
R3155:Anxa9 UTSW 3 95302405 missense probably benign 0.04
R3156:Anxa9 UTSW 3 95302405 missense probably benign 0.04
R3767:Anxa9 UTSW 3 95301114 missense probably benign 0.00
R4693:Anxa9 UTSW 3 95297356 missense probably benign 0.00
R4974:Anxa9 UTSW 3 95308013 unclassified probably benign
R5435:Anxa9 UTSW 3 95297250 missense probably damaging 1.00
R6342:Anxa9 UTSW 3 95296790 makesense probably null
R7272:Anxa9 UTSW 3 95305873 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTAGGAGAGTAGTGGACTGTCCC -3'
(R):5'- AGCCCAATTTGATGCCCAGGAAC -3'

Sequencing Primer
(F):5'- AGTAGTGGACTGTCCCACTCAG -3'
(R):5'- TTTGATGCCCAGGAACTGAGG -3'
Posted On2013-07-24