Incidental Mutation 'R2395:B3glct'
ID248488
Institutional Source Beutler Lab
Gene Symbol B3glct
Ensembl Gene ENSMUSG00000051950
Gene Namebeta-3-glucosyltransferase
SynonymsB3galtl, LOC381694
MMRRC Submission 040363-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R2395 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location149678230-149762599 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 149754186 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 427 (T427A)
Ref Sequence ENSEMBL: ENSMUSP00000097972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100404]
Predicted Effect probably damaging
Transcript: ENSMUST00000100404
AA Change: T427A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097972
Gene: ENSMUSG00000051950
AA Change: T427A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Fringe 93 216 7.4e-8 PFAM
Pfam:Fringe 253 470 1.8e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201088
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202302
Meta Mutation Damage Score 0.2693 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a beta-1,3-glucosyltransferase that transfers glucose to O-linked fucosylglycans on thrombospondin type-1 repeats (TSRs) of several proteins. The encoded protein is a type II membrane protein. Defects in this gene are a cause of Peters-plus syndrome (PPS).[provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,065,962 E622G probably benign Het
Abca8a A G 11: 110,068,788 Y707H probably damaging Het
Abcc3 A G 11: 94,357,306 V1156A possibly damaging Het
Acsl3 T C 1: 78,705,368 V661A probably benign Het
Cblc C A 7: 19,785,380 C341F probably damaging Het
Cntn2 T C 1: 132,526,372 S299G probably benign Het
Dcp1b T C 6: 119,215,064 S314P probably benign Het
Dnah6 T C 6: 73,091,967 probably null Het
Fam214b C A 4: 43,035,964 E256* probably null Het
Fmn1 A G 2: 113,365,181 T409A unknown Het
Hltf C T 3: 20,092,742 A555V probably benign Het
Kmt2c T C 5: 25,315,152 I1987V probably benign Het
Map3k10 T C 7: 27,673,993 E11G unknown Het
Micu1 G T 10: 59,863,202 E434* probably null Het
Mlph A G 1: 90,933,506 T288A probably benign Het
Myh13 A G 11: 67,364,922 E1679G probably benign Het
Myh15 A G 16: 49,069,514 N156S probably benign Het
Nab1 A G 1: 52,490,582 I52T probably damaging Het
Naip1 T C 13: 100,423,106 H1130R possibly damaging Het
Olfr1056 A G 2: 86,356,265 V39A probably benign Het
Olfr118 T G 17: 37,672,696 Y224* probably null Het
P2rx2 A G 5: 110,341,661 Y136H probably damaging Het
Prss40 A G 1: 34,559,905 V59A possibly damaging Het
Riox1 A T 12: 83,950,644 probably null Het
Rxrb T G 17: 34,037,438 C384W probably damaging Het
Srebf2 C T 15: 82,192,255 T702I probably benign Het
Tmprss5 T A 9: 49,115,135 L373* probably null Het
Trpm2 A C 10: 77,947,880 I253S possibly damaging Het
Ush2a C T 1: 188,947,040 T4815I probably damaging Het
Vmn2r73 A T 7: 85,857,767 M779K probably damaging Het
Other mutations in B3glct
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:B3glct APN 5 149696437 missense probably benign
IGL01066:B3glct APN 5 149709425 missense possibly damaging 0.88
IGL01953:B3glct APN 5 149745535 missense probably benign 0.00
IGL02093:B3glct APN 5 149732685 missense probably benign 0.08
IGL02344:B3glct APN 5 149726848 nonsense probably null
IGL03183:B3glct APN 5 149754142 missense probably damaging 1.00
IGL03277:B3glct APN 5 149726834 missense probably damaging 1.00
R0336:B3glct UTSW 5 149746592 missense probably damaging 1.00
R0782:B3glct UTSW 5 149726810 missense probably damaging 1.00
R0881:B3glct UTSW 5 149739569 missense probably damaging 1.00
R1445:B3glct UTSW 5 149754139 missense probably damaging 1.00
R2069:B3glct UTSW 5 149709380 missense probably damaging 1.00
R2164:B3glct UTSW 5 149754156 missense probably damaging 0.98
R2340:B3glct UTSW 5 149745440 missense probably benign 0.19
R4612:B3glct UTSW 5 149739557 missense probably damaging 1.00
R4751:B3glct UTSW 5 149725402 splice site probably null
R5303:B3glct UTSW 5 149754023 intron probably benign
R5405:B3glct UTSW 5 149709353 missense probably damaging 1.00
R5444:B3glct UTSW 5 149746520 missense probably damaging 1.00
R5616:B3glct UTSW 5 149729934 nonsense probably null
R5683:B3glct UTSW 5 149696437 missense probably benign
R6240:B3glct UTSW 5 149726788 missense probably benign 0.01
R6409:B3glct UTSW 5 149735451 missense probably benign
R6904:B3glct UTSW 5 149739604 splice site probably null
R6908:B3glct UTSW 5 149696476 critical splice donor site probably null
R7265:B3glct UTSW 5 149709320 missense probably benign 0.00
R7395:B3glct UTSW 5 149725604 intron probably null
R7543:B3glct UTSW 5 149754139 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGTAAACCAAAGCCCTC -3'
(R):5'- GCAAGTAAGCAAACAAGCTCAG -3'

Sequencing Primer
(F):5'- CAAAGCCCTCCATTAGGTTAAGTGG -3'
(R):5'- CTCAGCAGTTAAGAGCACTGGC -3'
Posted On2014-11-11