Incidental Mutation 'R2696:Ugt2b36'
ID251037
Institutional Source Beutler Lab
Gene Symbol Ugt2b36
Ensembl Gene ENSMUSG00000070704
Gene NameUDP glucuronosyltransferase 2 family, polypeptide B36
Synonyms
MMRRC Submission 040434-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R2696 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location87065927-87092555 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87089485 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 313 (M313K)
Ref Sequence ENSEMBL: ENSMUSP00000092233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094649] [ENSMUST00000132667] [ENSMUST00000145617]
Predicted Effect probably damaging
Transcript: ENSMUST00000094649
AA Change: M313K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000092233
Gene: ENSMUSG00000070704
AA Change: M313K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 527 6.9e-260 PFAM
Pfam:Glyco_tran_28_C 339 448 2e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000132667
AA Change: M187K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123024
Gene: ENSMUSG00000070704
AA Change: M187K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 105 1.1e-23 PFAM
Pfam:UDPGT 99 265 7.4e-95 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000145617
AA Change: M114K

PolyPhen 2 Score 0.836 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120005
Gene: ENSMUSG00000070704
AA Change: M114K

DomainStartEndE-ValueType
Pfam:UDPGT 22 249 2.1e-127 PFAM
Pfam:Glyco_tran_28_C 164 245 1.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154455
SMART Domains Protein: ENSMUSP00000120633
Gene: ENSMUSG00000070704

DomainStartEndE-ValueType
Pfam:UDPGT 1 198 1.2e-117 PFAM
Pfam:Glyco_tran_28_C 109 194 1.7e-9 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,850,364 T540S probably benign Het
Acp7 G T 7: 28,614,576 H369Q probably benign Het
Adgrg3 A G 8: 95,021,074 N65S probably benign Het
Anln A G 9: 22,360,963 V620A probably benign Het
Atp10a T A 7: 58,813,618 S966R probably benign Het
Atp8b3 T A 10: 80,534,183 Q132L possibly damaging Het
Col4a1 T A 8: 11,235,092 probably null Het
Ddx21 T C 10: 62,594,092 H291R possibly damaging Het
Dlgap3 A G 4: 127,194,623 Y4C probably damaging Het
Dnah5 A G 15: 28,278,576 N1106D probably benign Het
Esyt1 T C 10: 128,517,045 D662G probably damaging Het
F830016B08Rik T A 18: 60,300,736 V297E possibly damaging Het
Faf1 T A 4: 109,841,328 N328K possibly damaging Het
Gdf3 A C 6: 122,606,900 F169L probably benign Het
Ifi213 G A 1: 173,590,024 T274I probably benign Het
Igf2r T C 17: 12,695,344 D1746G possibly damaging Het
Ighv1-75 T C 12: 115,834,206 K32R probably benign Het
Ipo8 T A 6: 148,796,741 Q594L probably benign Het
Krt83 A T 15: 101,487,009 I402N probably benign Het
Med18 G A 4: 132,459,970 R118W probably damaging Het
Mmrn2 A G 14: 34,398,415 E414G probably damaging Het
Myo6 A G 9: 80,260,894 T447A probably benign Het
Ncoa6 T C 2: 155,438,015 E27G probably benign Het
Ngly1 T C 14: 16,283,439 L406S possibly damaging Het
Olfr125 T C 17: 37,835,107 I36T probably benign Het
Olfr630 A G 7: 103,755,528 I19T probably damaging Het
Phldb1 T C 9: 44,718,288 Y156C probably damaging Het
Pkd2l1 T A 19: 44,157,269 T172S probably benign Het
Pknox2 G A 9: 36,909,691 R292* probably null Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Polr3e T C 7: 120,933,377 L212P probably damaging Het
Ppp4r4 A G 12: 103,581,394 I215M possibly damaging Het
Psmg2 T C 18: 67,648,218 Y127H possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptp4a1 A T 1: 30,946,132 M4K probably benign Het
R3hcc1l A T 19: 42,563,988 I475L possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rsf1 GGC GGCGGCGGCGGC 7: 97,579,933 probably benign Het
Sec63 T A 10: 42,783,526 I70N probably benign Het
Slc2a5 A C 4: 150,120,746 K4T probably benign Het
Slc4a3 A G 1: 75,555,475 Y939C possibly damaging Het
Slc7a15 T C 12: 8,529,345 *229W probably null Het
Slco1a6 C A 6: 142,112,936 G206C probably damaging Het
Spata9 A G 13: 75,977,776 Q126R probably benign Het
Speg A T 1: 75,406,926 D1186V probably benign Het
Spink5 T G 18: 43,982,292 M197R probably damaging Het
Stab2 T C 10: 86,861,499 D1975G probably benign Het
Syngap1 T A 17: 26,957,411 C224* probably null Het
Ttn T C 2: 76,868,463 probably benign Het
Txnrd1 G A 10: 82,885,282 E397K probably benign Het
Ulk3 A G 9: 57,590,441 I74V possibly damaging Het
Zcchc4 T C 5: 52,796,231 V194A probably damaging Het
Zfp27 C T 7: 29,896,367 A58T possibly damaging Het
Zfp398 T G 6: 47,866,945 *512E probably null Het
Other mutations in Ugt2b36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Ugt2b36 APN 5 87081581 missense possibly damaging 0.73
IGL01024:Ugt2b36 APN 5 87080869 critical splice donor site probably null
IGL01295:Ugt2b36 APN 5 87080885 missense probably damaging 1.00
IGL01331:Ugt2b36 APN 5 87090942 missense probably damaging 1.00
IGL02597:Ugt2b36 APN 5 87080924 missense probably damaging 1.00
IGL02967:Ugt2b36 APN 5 87090900 missense possibly damaging 0.48
IGL03053:Ugt2b36 APN 5 87092074 missense possibly damaging 0.95
R0370:Ugt2b36 UTSW 5 87091975 missense probably benign 0.04
R0616:Ugt2b36 UTSW 5 87089477 missense probably benign 0.01
R0827:Ugt2b36 UTSW 5 87066375 missense possibly damaging 0.83
R0885:Ugt2b36 UTSW 5 87091989 missense probably benign 0.03
R1471:Ugt2b36 UTSW 5 87092071 missense probably damaging 1.00
R1567:Ugt2b36 UTSW 5 87092399 missense probably damaging 1.00
R1782:Ugt2b36 UTSW 5 87081581 missense possibly damaging 0.73
R1974:Ugt2b36 UTSW 5 87080868 critical splice donor site probably null
R2065:Ugt2b36 UTSW 5 87092241 missense probably benign 0.03
R2066:Ugt2b36 UTSW 5 87092241 missense probably benign 0.03
R2068:Ugt2b36 UTSW 5 87092241 missense probably benign 0.03
R2111:Ugt2b36 UTSW 5 87092241 missense probably benign 0.03
R2272:Ugt2b36 UTSW 5 87066255 missense possibly damaging 0.65
R4626:Ugt2b36 UTSW 5 87092088 missense probably damaging 1.00
R4700:Ugt2b36 UTSW 5 87092442 critical splice donor site probably null
R4731:Ugt2b36 UTSW 5 87081538 nonsense probably null
R4732:Ugt2b36 UTSW 5 87081538 nonsense probably null
R4733:Ugt2b36 UTSW 5 87081538 nonsense probably null
R4922:Ugt2b36 UTSW 5 87066324 missense probably damaging 1.00
R5217:Ugt2b36 UTSW 5 87066255 missense probably damaging 0.97
R5244:Ugt2b36 UTSW 5 87091906 missense probably damaging 0.99
R5341:Ugt2b36 UTSW 5 87092228 nonsense probably null
R5478:Ugt2b36 UTSW 5 87089482 missense probably damaging 1.00
R5572:Ugt2b36 UTSW 5 87089482 missense possibly damaging 0.89
R5722:Ugt2b36 UTSW 5 87092438 nonsense probably null
R5961:Ugt2b36 UTSW 5 87080865 splice site probably null
R6034:Ugt2b36 UTSW 5 87081518 missense probably damaging 1.00
R6034:Ugt2b36 UTSW 5 87081518 missense probably damaging 1.00
R6139:Ugt2b36 UTSW 5 87092171 missense probably benign
R6145:Ugt2b36 UTSW 5 87066213 missense probably benign
R6226:Ugt2b36 UTSW 5 87092130 missense probably damaging 0.99
R6531:Ugt2b36 UTSW 5 87081586 missense probably damaging 1.00
R6704:Ugt2b36 UTSW 5 87092131 missense probably damaging 1.00
R6895:Ugt2b36 UTSW 5 87092298 missense probably benign 0.06
R7218:Ugt2b36 UTSW 5 87081539 missense probably damaging 1.00
R7258:Ugt2b36 UTSW 5 87080903 missense probably damaging 1.00
R7310:Ugt2b36 UTSW 5 87066279 missense possibly damaging 0.94
R7650:Ugt2b36 UTSW 5 87080972 missense probably damaging 1.00
R7707:Ugt2b36 UTSW 5 87081508 critical splice donor site probably null
R7866:Ugt2b36 UTSW 5 87092331 missense probably damaging 1.00
R8098:Ugt2b36 UTSW 5 87092393 missense probably benign 0.02
R8123:Ugt2b36 UTSW 5 87092436 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACAATTAGAGCTTACCTAAACC -3'
(R):5'- TCGACTGTGCCAGTTCTGTC -3'

Sequencing Primer
(F):5'- CTTTAGGTTCCACACAGACATTC -3'
(R):5'- CTTCTCAGGAAATGGAAGACT -3'
Posted On2014-12-04