Incidental Mutation 'R2917:1700061G19Rik'
ID254921
Institutional Source Beutler Lab
Gene Symbol 1700061G19Rik
Ensembl Gene ENSMUSG00000024209
Gene NameRIKEN cDNA 1700061G19 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R2917 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location56875477-56888904 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56885141 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 568 (V568E)
Ref Sequence ENSEMBL: ENSMUSP00000025048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025048]
Predicted Effect probably damaging
Transcript: ENSMUST00000025048
AA Change: V568E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025048
Gene: ENSMUSG00000024209
AA Change: V568E

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
Pfam:AMP-binding 80 554 6.5e-68 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3m2 A G 8: 22,799,799 V96A probably benign Het
Bglap3 G C 3: 88,369,512 probably benign Het
Brd7 A G 8: 88,342,780 I429T probably damaging Het
Cacna1h A C 17: 25,395,452 L230R probably damaging Het
Camta2 A G 11: 70,680,961 F479S probably damaging Het
Cmya5 A T 13: 93,091,064 Y2505* probably null Het
Colgalt2 T A 1: 152,471,744 V143D probably damaging Het
Dnaja1 C T 4: 40,724,052 A71V possibly damaging Het
Gpr33 A G 12: 52,023,596 V220A possibly damaging Het
Hsph1 A T 5: 149,630,786 L168* probably null Het
Lig4 T A 8: 9,971,596 E728V possibly damaging Het
Mrps23 T C 11: 88,209,917 S75P probably damaging Het
Olfr223 T C 11: 59,589,439 T217A probably benign Het
Olfr313 A G 11: 58,817,488 N160S probably damaging Het
Prss50 G T 9: 110,862,545 G306C probably null Het
Rnf149 A T 1: 39,552,483 S392T probably benign Het
Scn8a T A 15: 101,039,732 F1661I probably damaging Het
Slc12a8 T A 16: 33,550,926 I144N probably damaging Het
Stxbp5l A T 16: 37,200,642 L630* probably null Het
Tmem131l G A 3: 83,937,580 R441* probably null Het
Trim63 T C 4: 134,323,151 Y249H probably damaging Het
Vmn2r125 T G 4: 156,351,269 L314R probably benign Het
Vwf A G 6: 125,608,143 N663D probably benign Het
Other mutations in 1700061G19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:1700061G19Rik APN 17 56882203 nonsense probably null
IGL01833:1700061G19Rik APN 17 56881062 missense probably benign 0.02
IGL02420:1700061G19Rik APN 17 56880494 missense probably damaging 1.00
IGL02969:1700061G19Rik APN 17 56883751 missense probably damaging 1.00
IGL03054:1700061G19Rik UTSW 17 56886528 missense possibly damaging 0.67
R0197:1700061G19Rik UTSW 17 56883835 missense probably benign 0.01
R0257:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0279:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0280:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0281:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0282:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0329:1700061G19Rik UTSW 17 56883631 missense probably benign 0.02
R0330:1700061G19Rik UTSW 17 56883631 missense probably benign 0.02
R0349:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0518:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0519:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0521:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0604:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0883:1700061G19Rik UTSW 17 56883835 missense probably benign 0.01
R1561:1700061G19Rik UTSW 17 56877431 missense probably benign
R1779:1700061G19Rik UTSW 17 56885169 nonsense probably null
R2008:1700061G19Rik UTSW 17 56886478 missense probably benign 0.04
R2102:1700061G19Rik UTSW 17 56884949 nonsense probably null
R2247:1700061G19Rik UTSW 17 56877435 missense possibly damaging 0.83
R2484:1700061G19Rik UTSW 17 56882641 missense probably benign 0.00
R3149:1700061G19Rik UTSW 17 56876348 missense probably benign
R3773:1700061G19Rik UTSW 17 56876262 start codon destroyed probably null 0.00
R4829:1700061G19Rik UTSW 17 56883500 splice site probably null
R4860:1700061G19Rik UTSW 17 56888655 missense probably benign 0.09
R4860:1700061G19Rik UTSW 17 56888655 missense probably benign 0.09
R4887:1700061G19Rik UTSW 17 56876324 missense possibly damaging 0.84
R5043:1700061G19Rik UTSW 17 56885198 missense probably damaging 1.00
R5112:1700061G19Rik UTSW 17 56877465 missense probably benign 0.03
R5161:1700061G19Rik UTSW 17 56882888 missense possibly damaging 0.84
R5214:1700061G19Rik UTSW 17 56886493 missense probably benign
R5287:1700061G19Rik UTSW 17 56876221 unclassified probably benign
R5403:1700061G19Rik UTSW 17 56876221 unclassified probably benign
R5779:1700061G19Rik UTSW 17 56881061 missense probably benign 0.02
R5997:1700061G19Rik UTSW 17 56876373 missense probably benign 0.02
R6198:1700061G19Rik UTSW 17 56882679 missense probably damaging 1.00
R6259:1700061G19Rik UTSW 17 56877513 missense probably benign 0.04
R6357:1700061G19Rik UTSW 17 56877591 critical splice donor site probably null
R6754:1700061G19Rik UTSW 17 56883358 missense probably damaging 0.99
R6842:1700061G19Rik UTSW 17 56877432 missense probably benign 0.00
R7042:1700061G19Rik UTSW 17 56885098 missense possibly damaging 0.73
R7181:1700061G19Rik UTSW 17 56881037 missense probably benign 0.03
R7445:1700061G19Rik UTSW 17 56882973 missense possibly damaging 0.64
R7511:1700061G19Rik UTSW 17 56882954 missense probably damaging 0.98
Z1177:1700061G19Rik UTSW 17 56883463 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTGACAAGTTCCTCTATGTCATGG -3'
(R):5'- TGCTTCTGATTAGGTATTTAGTCACA -3'

Sequencing Primer
(F):5'- CAAGTTCCTCTATGTCATGGGGAAC -3'
(R):5'- TTAGTCACAATGAACAAAACAAAAGG -3'
Posted On2014-12-29