Incidental Mutation 'R0604:1700061G19Rik'
ID55605
Institutional Source Beutler Lab
Gene Symbol 1700061G19Rik
Ensembl Gene ENSMUSG00000024209
Gene NameRIKEN cDNA 1700061G19 gene
Synonyms
MMRRC Submission 038793-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R0604 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location56875477-56888904 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 56885169 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 577 (Y577*)
Ref Sequence ENSEMBL: ENSMUSP00000025048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025048]
Predicted Effect probably null
Transcript: ENSMUST00000025048
AA Change: Y577*
SMART Domains Protein: ENSMUSP00000025048
Gene: ENSMUSG00000024209
AA Change: Y577*

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
Pfam:AMP-binding 80 554 6.5e-68 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik C A 2: 28,466,091 R60L possibly damaging Het
Acap1 T C 11: 69,884,625 E302G probably benign Het
Adrb2 G A 18: 62,178,515 T413I possibly damaging Het
Aqr T C 2: 114,130,604 K725R probably benign Het
Braf A G 6: 39,623,697 I662T probably damaging Het
Ccdc178 A G 18: 22,067,443 S435P probably benign Het
Chd9 A G 8: 91,036,542 M2332V possibly damaging Het
Clgn T C 8: 83,424,194 V496A probably benign Het
Dnah17 A C 11: 118,121,471 S193R probably benign Het
Dntt A G 19: 41,053,149 E424G probably benign Het
Fam149a A G 8: 45,345,008 L492P probably damaging Het
Fetub T C 16: 22,935,660 Y126H possibly damaging Het
Fgfr3 A T 5: 33,732,782 Y96F probably damaging Het
Gm4952 A G 19: 12,624,672 E148G probably benign Het
Gucy2g T A 19: 55,203,087 L977F probably benign Het
Il1r1 T C 1: 40,282,246 V6A probably benign Het
Itsn2 C A 12: 4,658,189 Q832K probably benign Het
Lats1 T A 10: 7,712,661 F1014Y probably damaging Het
Mcc G A 18: 44,473,756 A536V probably damaging Het
Mtrf1 T C 14: 79,415,887 V334A possibly damaging Het
Olfr1179 T C 2: 88,402,383 T184A probably benign Het
Olfr325 T A 11: 58,581,348 M168K probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr50 T A 2: 36,794,107 Y290* probably null Het
Pard6g A G 18: 80,117,208 S179G probably damaging Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Psg27 A T 7: 18,557,072 V402D probably damaging Het
Rttn A G 18: 88,977,758 I222V probably damaging Het
Sp9 T A 2: 73,273,638 S179T probably benign Het
Tbc1d8 T A 1: 39,405,326 H184L probably damaging Het
Vmn1r69 A G 7: 10,580,654 V50A probably benign Het
Vmn2r58 A G 7: 41,860,576 F526L possibly damaging Het
Other mutations in 1700061G19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:1700061G19Rik APN 17 56882203 nonsense probably null
IGL01833:1700061G19Rik APN 17 56881062 missense probably benign 0.02
IGL02420:1700061G19Rik APN 17 56880494 missense probably damaging 1.00
IGL02969:1700061G19Rik APN 17 56883751 missense probably damaging 1.00
IGL03054:1700061G19Rik UTSW 17 56886528 missense possibly damaging 0.67
R0197:1700061G19Rik UTSW 17 56883835 missense probably benign 0.01
R0257:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0279:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0280:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0281:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0282:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0329:1700061G19Rik UTSW 17 56883631 missense probably benign 0.02
R0330:1700061G19Rik UTSW 17 56883631 missense probably benign 0.02
R0349:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0518:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0519:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0521:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0883:1700061G19Rik UTSW 17 56883835 missense probably benign 0.01
R1561:1700061G19Rik UTSW 17 56877431 missense probably benign
R1779:1700061G19Rik UTSW 17 56885169 nonsense probably null
R2008:1700061G19Rik UTSW 17 56886478 missense probably benign 0.04
R2102:1700061G19Rik UTSW 17 56884949 nonsense probably null
R2247:1700061G19Rik UTSW 17 56877435 missense possibly damaging 0.83
R2484:1700061G19Rik UTSW 17 56882641 missense probably benign 0.00
R2917:1700061G19Rik UTSW 17 56885141 missense probably damaging 1.00
R3149:1700061G19Rik UTSW 17 56876348 missense probably benign
R3773:1700061G19Rik UTSW 17 56876262 start codon destroyed probably null 0.00
R4829:1700061G19Rik UTSW 17 56883500 splice site probably null
R4860:1700061G19Rik UTSW 17 56888655 missense probably benign 0.09
R4860:1700061G19Rik UTSW 17 56888655 missense probably benign 0.09
R4887:1700061G19Rik UTSW 17 56876324 missense possibly damaging 0.84
R5043:1700061G19Rik UTSW 17 56885198 missense probably damaging 1.00
R5112:1700061G19Rik UTSW 17 56877465 missense probably benign 0.03
R5161:1700061G19Rik UTSW 17 56882888 missense possibly damaging 0.84
R5214:1700061G19Rik UTSW 17 56886493 missense probably benign
R5287:1700061G19Rik UTSW 17 56876221 unclassified probably benign
R5403:1700061G19Rik UTSW 17 56876221 unclassified probably benign
R5779:1700061G19Rik UTSW 17 56881061 missense probably benign 0.02
R5997:1700061G19Rik UTSW 17 56876373 missense probably benign 0.02
R6198:1700061G19Rik UTSW 17 56882679 missense probably damaging 1.00
R6259:1700061G19Rik UTSW 17 56877513 missense probably benign 0.04
R6357:1700061G19Rik UTSW 17 56877591 critical splice donor site probably null
R6754:1700061G19Rik UTSW 17 56883358 missense probably damaging 0.99
R6842:1700061G19Rik UTSW 17 56877432 missense probably benign 0.00
R7042:1700061G19Rik UTSW 17 56885098 missense possibly damaging 0.73
R7181:1700061G19Rik UTSW 17 56881037 missense probably benign 0.03
R7445:1700061G19Rik UTSW 17 56882973 missense possibly damaging 0.64
R7511:1700061G19Rik UTSW 17 56882954 missense probably damaging 0.98
R8122:1700061G19Rik UTSW 17 56886670 missense possibly damaging 0.50
R8553:1700061G19Rik UTSW 17 56881021 missense probably benign 0.02
Z1177:1700061G19Rik UTSW 17 56883463 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCTCCACTTCCTAGAGAAGGGGATGT -3'
(R):5'- GCCTGCCTTTCCAAAGAGGCTTAAT -3'

Sequencing Primer
(F):5'- CTAGAGAAGGGGATGTTTGGG -3'
(R):5'- ctcaccagtctcctcccc -3'
Posted On2013-07-11