Incidental Mutation 'R2926:Mrps33'
ID255756
Institutional Source Beutler Lab
Gene Symbol Mrps33
Ensembl Gene ENSMUSG00000029918
Gene Namemitochondrial ribosomal protein S33
SynonymsPTD003, MRP-S33, Gdap3, CGI-139
MMRRC Submission 040511-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R2926 (G1)
Quality Score222
Status Validated
Chromosome6
Chromosomal Location39801804-39810988 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39805504 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 28 (S28P)
Ref Sequence ENSEMBL: ENSMUSP00000144539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031978] [ENSMUST00000114797] [ENSMUST00000201461]
Predicted Effect probably benign
Transcript: ENSMUST00000031978
AA Change: S28P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000031978
Gene: ENSMUSG00000029918
AA Change: S28P

DomainStartEndE-ValueType
Pfam:MRP-S33 7 96 2.5e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114797
AA Change: S28P

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139992
Predicted Effect probably damaging
Transcript: ENSMUST00000201461
AA Change: S28P

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.1484 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. The 28S subunit of the mammalian mitoribosome may play a crucial and characteristic role in translation initiation. This gene encodes a 28S subunit protein that is one of the more highly conserved mitochondrial ribosomal proteins among mammals, Drosophila and C. elegans. Splice variants that differ in the 5' UTR have been found for this gene; all variants encode the same protein. Pseudogenes corresponding to this gene are found on chromosomes 1q, 4p, 4q, and 20q [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 G T 5: 124,078,839 S438R possibly damaging Het
Add3 A G 19: 53,226,822 probably null Het
Adgrb2 T C 4: 130,008,344 L506P probably damaging Het
Atp6v0a1 A T 11: 101,043,948 I621L probably damaging Het
AV320801 G T X: 135,499,548 A96S possibly damaging Het
Calb1 T G 4: 15,904,302 L218R probably damaging Het
Ccdc162 G A 10: 41,561,207 probably benign Het
Ccser2 A T 14: 36,879,561 S842T possibly damaging Het
Cd300a A G 11: 114,893,313 E49G possibly damaging Het
Colec11 T A 12: 28,617,429 Q37L probably damaging Het
D630045J12Rik T A 6: 38,168,171 I1307F probably damaging Het
Dapk1 T C 13: 60,719,750 V257A possibly damaging Het
Dnah3 T A 7: 119,951,115 N3327I probably damaging Het
Gja8 C T 3: 96,919,153 V398I probably benign Het
Gm4450 A G 3: 98,450,556 probably benign Het
Hfm1 A T 5: 106,874,282 L179* probably null Het
Ift88 T C 14: 57,488,918 Y678H probably damaging Het
Itga10 A G 3: 96,652,849 N560D probably damaging Het
Itpk1 G T 12: 102,579,130 P238Q probably damaging Het
Kl T C 5: 150,953,341 W209R probably damaging Het
Lama4 A G 10: 39,078,832 N1127S probably benign Het
Lrp1 C T 10: 127,588,113 C830Y probably damaging Het
Mcmbp G A 7: 128,698,014 probably benign Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Myt1 C T 2: 181,826,010 T1079M possibly damaging Het
N4bp1 A T 8: 86,861,796 Y171* probably null Het
Ncln G T 10: 81,488,438 T442K probably benign Het
Nphp4 T C 4: 152,518,139 V390A probably damaging Het
Ntrk2 C A 13: 59,060,284 T648K probably damaging Het
Nwd1 A G 8: 72,667,012 H301R probably damaging Het
Olfr729 A T 14: 50,148,436 V146E probably benign Het
Pcdh12 T C 18: 38,282,390 N561D probably damaging Het
Pcnx T A 12: 81,994,995 S2134T probably damaging Het
Ppp1cc G A 5: 122,174,088 A306T probably benign Het
Prrc2c C T 1: 162,706,127 probably benign Het
Rabggta C T 14: 55,719,290 R319H probably benign Het
Scn10a A C 9: 119,638,701 F791C possibly damaging Het
Stab1 T A 14: 31,161,799 D267V probably damaging Het
Sva A T 6: 42,042,662 Y152F possibly damaging Het
Tgfbrap1 T G 1: 43,075,629 M104L probably damaging Het
Tmed4 T C 11: 6,271,728 T203A probably benign Het
Toe1 C T 4: 116,804,980 A331T possibly damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trpm7 T C 2: 126,858,409 probably benign Het
Ttll7 C T 3: 146,930,415 R438* probably null Het
Usp11 G T X: 20,717,792 G601W probably damaging Het
Vmn2r112 A G 17: 22,615,003 T551A possibly damaging Het
Vmn2r73 T C 7: 85,871,663 K366E probably benign Het
Vps33a A G 5: 123,569,571 I111T possibly damaging Het
Other mutations in Mrps33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Mrps33 APN 6 39802513 nonsense probably null
R0544:Mrps33 UTSW 6 39805554 missense possibly damaging 0.94
R1800:Mrps33 UTSW 6 39802495 missense probably damaging 1.00
R6481:Mrps33 UTSW 6 39805370 critical splice donor site probably null
R6722:Mrps33 UTSW 6 39805665 start gained probably benign
R6781:Mrps33 UTSW 6 39805823 start gained probably benign
R7440:Mrps33 UTSW 6 39802479 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTGTAGTGAGTCCCAAGC -3'
(R):5'- TGTCAAGTGGGCATGTCTCC -3'

Sequencing Primer
(F):5'- CTGTAGTGAGTCCCAAGCTAATTG -3'
(R):5'- GCCATAATAATTCATGGGTGGC -3'
Posted On2014-12-29